Search Strains

Superficially wild-type. C-terminal tag of GYF-1 via CRISPR/Cas9 knock-in of mNeonGreen at gyf-1 locus. Insertion verified by PCR. Left flank: 5' CCATCGGCTCCGGTGAATCCTTCGCGCCGT 3'; Right flank: 5' TAGatgagtcatttctttttccagctttaa 3'. sgRNA: 5' TGACTCATCTAACGGCGCGA 3'

N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.

N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.

C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.

C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.

N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.

Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.

N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.

Superficially wild-type. N-terminal tag of W08E12.7 via CRISPR/Cas9 knock-in of mNeonGreen at W08E12.7 locus. Insertion verified by PCR. Left flank: 5' ttcaatgtttattctttcagatagatcaaa 3'; Right flank: 5' ATGGTTAGAAAGGACAGTGAGAGTAGTTGTTCAAGTGATGG 3' (6 silent mutations). sgRNA: 5' GAAAGCAGCTGCTCCAGCGA 3'

N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3’ (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62.

N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3’ (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64.

N-terminal tag of H34C03.2 via CRISPR/Cas9 knock-in of mNeonGreen at H34C03.2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gggattgcctacactcaaatatacgtaacg 3'; Right flank: 5' ATGCCCACGCCGGAAGTGTTCCCATGGATG 3’ (4 silent mutations); gRNA: cgtaacgATGCCAACTCCCG; Cas9/sgRNA plasmid: pGLOW9; mNG^SEC^3xFlag plasmid: pGLOW106; SEC insertion allele strain: GLW72.

N-terminal tag of JNK-1 via CRISPR/Cas9 knock-in of mNeonGreen at jnk-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' cagcaagttaaagtgtgtgatcctgtgcac 3'; Right flank: 5' ATGGAGGAACGATTATCCACAACATCATCG 3’; gRNA: gtgtgatcctgtgcacATGG; Cas9/sgRNA plasmid: pGLOW114a; mNG^SEC^3xFlag plasmid: pGLOW116; SEC insertion allele strain: GLW76.

N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.

Slow growing. N-terminal tag of EEL-1 via CRISPR/Cas9 knock-in of mNeonGreen at eel-1 locus. Insertion verified by PCR. Left flank: 5' gacaagcgggttttttgaatcgtttcgaaa 3'; Right flank: 5' ATGAAGATTGACGATGCTGAGCCGAGCTCTAGTTCATCGGGCTCCGATAT 3' (6 silent mutations). sgRNA: 5' GACCCGGAAGAGCTTGAACT 3'

N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84.

N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.

C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.

N-terminal tag of CLIC-1 via CRISPR/Cas9 knock-in of mScarlet at clic-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CTCGTACCAATCGTCCGCAA 3’; rev – 5’ CCATCTTGTTGCTTGGCGAAA 3’. Left flank: 5' ccagggtataaaacacaaaaaaactacaaa 3'; Right flank: 5' ATGTCGGATCCAGTCGCGGATTTTTTGGCT 3’ (1 silent mutation); sgRNA: ctacaaaATGTCGGATCCAG; Cas9/sgRNA plasmid: pGLOW128; mScarlet^SEC^3xMyc plasmid: pGLOW156; SEC insertion allele strain: GLW92.

C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AAATCGTGCTCTCCCAAGCA 3’; rev – 5’ CTTGTCACCTGACGGGATGT 3’. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94.

dvIs100 [unc-54p::A-beta-1-42::unc-54 3'-UTR + mtl-2p::GFP]. mtl-2p::GFP produces constitutive expression of GFP in intestinal cells. unc-54p::A-beta-1-42 expresses full-length human A-beta-1-42 peptide in bodywall muscle cells that aggregates in vivo. Shifting L4 or young adult animals from 20C to 25C causes paralysis. Reference: McColl G, et al. Mol Neurodegener. 2012 Nov 21;7:57.

pgIs2 [gcy-8p::TU#813 + gcy-8p::TU#814 + unc-122p::GFP + gcy-8p::mCherry + gcy-8p::GFP + ttx-3p::GFP]. TU#813 and TU#814 are split caspase vectors (Chalfie Lab) subcloned downstream of the gcy-8 promoter. Expression of GFP in coelomocytes and AIY neuron, and mCherry in AFD neuron when caspase activity is lost. Reference: Glauser DA, et al. Genetics. 2011 May;188(1):91-103.

pgEx116 [unc-70::TSmod + myo3p::mCherry]. Pick animals with red fluorescence in body wall muscle to maintain array. The tension sensor module (TSMod) was inserted into the coding sequence of unc-70. TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, which acts as an entropic nanospring suitable for estimating biologically relevant forces. Reference: Krieg M, et al. Nat Cell Biol. 2014 Mar;16(3):224-33.

pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP]. The tension sensor module control (N-TSMod) was inserted at the N-terminus of unc-70. N-TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, but is placed at the N-terminus of UNC-70 where it is not sensitive to force. pgIs22 was a spontaneous insertion of pgEx157. Reference: Kelley M, et al. Elife. 2015 Mar 23;4.

GFP inserted into the endogenous eff-1 gene at its C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in V.a cell 20min before cell-cell fusion in larvae. Very weak fluorescence in hyp7 cell. Reference: Yang Y, et al. Dev Cell. 2017 Apr 10;41(1):107-120.

Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous che-3 locus at the N-terminus and tagRFP::3xFlag inserted into the endogenous xbx-1 locus at the C-terminus by Cas9-triggered homologous recombination. Fluorescence enriched in most if not all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

Constructed by crossing individual fluorescence knock-in worms. GFP inserted into the endogenous klp-20 gene at its C-terminus, tagRFP::3xFlag inserted into the endogenous xbx-1 gene at its C-terminus and tagBFP inserted into the endogenous ift-81 gene at its C-terminus by Cas9-triggered homologous recombination. GFP enriched at the proximal region (middle segment) of amphid or phasmid sensory cilia while red and blue fluorescence enriched along the whole cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

GFP inserted into the endogenous ift-74 locus at the C-terminus by Cas9-triggered homologous recombination. Green fluorescence enriched in most, if not, all sensory cilia. Very weak fluorescence in the cell bodies of ciliated neurons.

GFP inserted at the N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

unc-70(cas1050) removes nine amino acids (H590-L598) in the SCA5-associated deletion in ?-spectrin and inserts GFP at N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

Animals with mnDp31 are WT and segregate WT and dead embryos. (Animals which have lost mnDp31 arrest as embryos.)

Heterozygotes are WT and segregate WT and DpyUnc. age-1(mg44) homozygotes from heterozygous mothers are WT and segregate only dauers at all temperatures. mg44 pka daf-23(mg44).

Mutation resulted from the imprecise loss of pk37::Tc1. Incompletely penetrant sterile and lethal. Defects in oocyte cell cycle arrest, gonad migration, and hypodermal differentiation. See also WBPaper00002965.

age-1(mg44) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive); can be rescued zygotically. age-1(mg44) homozygous animals that are maternally rescued for dauer formation are long-lived. mg44 is a Trp405 Amber mutation. Heterozygotes are WT and segregate WT (1/3 of which throw only dauers) and DpyUncs.

Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.

mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.

mgDf47 completely suppresses daf-c phenotype of daf-2. mgDf47 deletes approximately 8kb of the daf-16 gene beginning after exon 4.

No visible phenotype. Dominant suppressor of daf-c phenotype of age-1.

mgDf90 completely eliminates the daf-3 coding region.

No visible phenotype. Dominant suppressor of daf-c phenotype of age-1. Ala303Val substitution.

Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.

mgEx470 [pdk-1(+) + ttx-3::GFP]. Pick GFP+ to maintain. 9.2-kb PCR product of genomic DNA from the pdk-1(+) genomic region containing 2.7 kb of 5' upstream regulatory sequence, 6.1 kb of coding sequencing containing introns and exons, and 0.4 kb of pdk-1 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.

yzIs71 [tph-1p::GFP + rol-6(su1006)] V. Rollers. tph-1 transcriptional reporter containing 3.1kb of tph-1 5’ regulatory sequence through the beginning of exon 4. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Sze JY, et al. Nature. 2000 Feb 3;403(6769):560-4.

njEx32 [ges-1p::daf-2(+) + ges-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

njEx38 [unc-54p::daf-2(cDNA)::unc-54 3'UTR + unc-54p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgEx376 [unc-14p::daf-2 + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).

Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366).

Enhances retarded differentiation of the hypodermis and exit from the molting cycle caused by mutations in let-7 or its paralogs. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.