F43E2.8. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

zcIs4 [hsp-4::GFP] V. uthIs269 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. ER stress resistence. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47.

zcIs4 [hsp-4::GFP] V. vit-1(ac2) is a dominant allele that causes ER stress. Since vit-1 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

zcIs4 [hsp-4::GFP] V. vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

zcIs4 [hsp-4::GFP] V. vit-4(ac4) is a dominant allele that causes ER stress. Since vit-4 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

zcIs4 [hsp-4::GFP] V. vit-5(ac5) is a dominant allele that causes ER stress. Since vit-5 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

zcIs4 [hsp-4::GFP] V. vit-6(ac6) is a dominant allele that causes ER stress. Since vit-6 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17.

C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.

zcIs4 [hsp-4::GFP] V. xbp-1(zc12) animals contain a nonsense mutation at residue 11 in the predicted xbp-1 protein. Animals are unable to induce hsp-4::GFP in response to treatment by tunicamycin or heat shock.

zcIs4 [hsp-4::GFP] V. Animals contain a missense mutation (G739R) in the kinase domain of ire-1. They are unable to induce hsp-4(BiP0 in response to tumincamycin, or heat shock.

zcIs4 [hsp-4::GFP] V. The hsp-4::GFP reporter integrated within the cluster of LG V. Animals express low levels of GFP under basal conditions. However, expression in the gut and hypodermis can increase in response to tunicamycin treatment or heat shock.

zcIs4 [hsp-4::GFP] V. The identity of upr-1 remains unknown. Animals containing the zc6 mutation can be detected in an hsp-4::GFP background by following the bright green tails under fluorescence microscopy.

C14F11.5. Homozygous. Outer Left Sequence: ATTGCGACTTTCTGAGCGAT. Outer Right Sequence: CCATGTGATCACCCTATCCC. Inner Left Sequence: ATCATTTTTGACCAAAGGCG. Inner Right Sequence: GATCATCATCGTCCAACGTG. Inner primer WT PCR product: 2626. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

vkEx737 [hsp-4p::GFP + myo-2p::mCherry]. Reference: Miedel MT, et al. PLoS One. 2012;7(7):e40145.