More Fields
Strain Species Genotype
CF1038 C. elegans daf-16(mu86) I. Show Description
Dauer defective. Short lived.
DR26 C. elegans daf-16(m26) I. Show Description
Dauer defective-leaky. Somewhat small. Suppresses daf-2.
DR27 C. elegans daf-16(m27) I. Show Description
Dauer defective. Chemotaxis normal. Class 2 suppressor of dauer constitutive.
OH13908 C. elegans daf-16(ot821[daf-16::mKate2::3xFLAG]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with mKate2::3xFLAG. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH14125 C. elegans daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID]) I. Show Description
mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580
OH16024 C. elegans daf-16(ot971[daf-16::GFP]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with GFP. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH16029 C. elegans daf-16(ot975[daf-16::mNeptune2.5::AID]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with mNeptune2.5::AID. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
TJ356 C. elegans zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.
CF1139 C. elegans daf-16(mu86) I; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. muIs61 insertion point has not been mapped.
CF1308 C. elegans daf-16(mu86) I; muEx116. Show Description
muEx116 [daf-16a::GFP(T54A S240A T242A S314A) + rol-6(su1006)]. Grows at all temperatures. Carries extrachromosomal array. Pick Rollers to maintain.
CF1330 C. elegans daf-16(mu86) I; muEx128. Show Description
muEx128 [(pKL79) daf-16a::GFP) + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain.
CF1371 C. elegans daf-16(mu86) I; muEx151. Show Description
muEx151 [(pKL106-8) daf-16aAM::GFP/bKO + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain.
CF1407 C. elegans daf-16(mu86) I; muIs71 X. Show Description
muIs71 [(pKL99) daf-16ap::GFP::daf-16a(bKO)) + rol-6(su1006)]. Grows okay at 20C. Spontaneous integrant. Rollers.
CF2060 C. elegans daf-16(mu86) I; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
GR1307 C. elegans daf-16(mgDf50) I. Show Description
Deficiency completely eliminates daf-16 coding region. Makes partial dauers on pheromone.
MAH20 C. elegans daf-16(mu86) I; adIs2122. Show Description
adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.
AGK650 C. elegans daf-16(mu86) I; zdIs13 IV; armEx257. Show Description
zdIs13 [tph-1p::GFP] IV. armEx257 [dpy-7p::daf-16b::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx257 rescues the daf-16(mu86) HSN undermigration phenotype. dpy-7p::daf-16b::tagRFP expression is localized to nuclei in hypodermal tissue during the comma, 1.5 and 2-fold stages, becoming cytoplasmic or perinuclear by the 3-fold stage and persisting into adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
CF1874 C. elegans daf-16(mu86) I; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva.
CF1880 C. elegans daf-16(mu86) I; glp-1(e2141) III. Show Description
Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86).
DR1309 C. elegans daf-16(m26) I; daf-2(e1370) III. Show Description
DR1408 C. elegans daf-16(m26) I; age-1(m333) II. Show Description
Egl phenotype, viable. Lethality and Daf-c phenotype of m333 suppressed by daf-16 (m333 alone is a maternal-effect non-conditional dauer constitutive). age-1(m333) pka daf-23(m333).
DR195 C. elegans dpy-5(e61) daf-16(m26) I. Show Description
Dauer defective. Leaky. Dpy.
DR211 C. elegans daf-16(m26) unc-75(e950) I. Show Description
Dauer defective. Unc.
DR234 C. elegans dpy-5(e61) daf-16(m27) I. Show Description
Dauer defective. Dpy.
ENL62 C. elegans daf-16(mu86) I; sma-10(ok2224) IV. Show Description
Derived from RB1739 and CF1038.
GR1308 C. elegans daf-16(mg54) I; daf-2(e1370) III. Show Description
mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.
GR1352 C. elegans daf-16(mgDf47) I; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. GFP expressed in many tissues. Partially rescued for daf-16 (daf-d).
KN478 C. elegans daf-16(mu86) I; huIs33. Show Description
huIs33 [sod-3::GFP + rol-6(su1006)]. Pick Rollers to maintain.
MQ1050 C. elegans daf-16(m26) I; isp-1(qm150) IV. Show Description
Slow development.
OH14654 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted
OH14888 C. elegans daf-16(ot853[daf-16::mNG::3xFlag::AID]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
OH14897 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi60 II; daf-2(e1370) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH14945 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi61 II; daf-2(e1370) III. Show Description
ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH15845 C. elegans daf-16(ot853[daf-16::mNG::AID]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH16508 C. elegans daf-16(ot975[daf-16::mNeptune2.5::3xFlag::AID]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
AGD1048 C. elegans daf-16(mu86) I; glp-1(e2141) III; uthEx649. Show Description
uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C; sterile at 25C. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AU147 C. elegans daf-16(mgDf47) I; glp-1(e2141) III. Show Description
Temperature sensitive sterility. Maintain at 15C.
AU166 C. elegans daf-16(mgDf47) I; fog-2(q71) V. Show Description
Temperature sensitive. Maintain at 15C.
CF1137 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs61. Show Description
muIs61 [daf-16a::GFP + rol-6(su1006)]. Temperature-sensitive. Maintain at 15 C. Rollers. Reference: Lin K, Hsin H, Libina N, Kenyon C. Nat Genet. 2001 Jun;28(2):139-45.
CF1295 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx108. Show Description
muEx108 [(pKL99-2) daf-16::GFP/daf16bKO + rol-6(su1006)]. Grows okay at 20C. Rollers should form dauers at 25C. Pick Rollers to maintain.
CF1380 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1442 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx169. Show Description
muEx169 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Pick Rollers to maintain.
CF1449 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx176. Show Description
muEx176 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Pick rollers to maintain -- Low transmission rate! Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1514 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx211. Show Description
muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1515 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx212. Show Description
muEx212[pNL212(myo-3p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1595 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx227. Show Description
muEx227 [(pNL213) ges-1p::GFP::daf-16) + rol-6(su1006)]. Pick Rollers to maintain.
CF1700 C. elegans daf-16(mu86) I; mes-1(bn7) X; muEx248. Show Description
muEx248 [(pNL209) daf-16::GFP::daf-16(cDNA) + podr-1::RFP]. Pick green (body) / red (head neurons) animals. Transmission efficiency ~50%. Can be grown at 20C with some sterility (30-50%). The higher the temperture, the greater the sterility.
CF1724 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs105. Show Description
muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1827 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx268. Show Description
muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain.
CF1935 C. elegans daf-16(mu86) I; glp-1(e2141) III; muIs109. Show Description
muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less.