More Fields
Strain Species Genotype
BC15531 C. elegans dpy-5(e907) I; sEx15531. Show Description
sEx15531 [rCes ZK1058.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
GLW45 C. elegans ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
RB1434 C. elegans mmcm-1(ok1637) III. Show Description
ZK1058.1 Homozygous. Diminished ablility to incorporate C14 labled propionate into protein (data provided by Randy Chandler). Outer Left Sequence: cgcgaaaattaacgagaagc. Outer Right Sequence: cagccaattttctgtgggtt. Inner Left Sequence: cggtcttcccaatttcttga. Inner Right Sequence: ttcccaaaatttcgttgctc. Inner Primer PCR Length: 3097. Deletion size: 990 bp. Left flank: TAGTCTCAAAATCAGATATACACAAAAATC. Right flank: ATGGCAAGTACTGGAACGACAGCTCCGTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC791 C. elegans ccdc-47(gk356) III. Show Description
ZK1058.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807