Strain Information
| Name | GLW47 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | hsp-4(utx39[hsp-4::mNG::3xFlag]) II. |
| Description | C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Quincy Martin (Glow Worms '21) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.