Strain Information
| Name | GLW6 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | W08E12.7(utx6[mNG::W08E12.7]) IV. |
| Description | Superficially wild-type. N-terminal tag of W08E12.7 via CRISPR/Cas9 knock-in of mNeonGreen at W08E12.7 locus. Insertion verified by PCR. Left flank: 5' ttcaatgtttattctttcagatagatcaaa 3'; Right flank: 5' ATGGTTAGAAAGGACAGTGAGAGTAGTTGTTCAAGTGATGG 3' (6 silent mutations). sgRNA: 5' GAAAGCAGCTGCTCCAGCGA 3' |
| Mutagen | CRISPR/Cas9 homologous recombination |
| Outcrossed | x0 |
| Made by | Aubrie Rettmann (Glow Worms '20) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.