Strain Information
| Name | GLW85 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | pqe-1(utx65[mScarlet-I-C1::3xMyc::pqe-1]) III. |
| Description | N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Ann Houghton (Glow Worms '22) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.