uthIs225 [sur5p::hsf-1(CT-Delta)::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.

wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keeps plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. Reference: Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790. https://doi.org/10.48550/arXiv.2208.04790

wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keeps plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623 Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790. https://doi.org/10.48550/arXiv.2208.04790

wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keeps plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. unc-31(wtf502) is a CRISPR-engineered deletion allele. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623 Randi F, et al. (2022). A functional connectivity atlas of C. elegans measured by neural activation. arXiv:2208.04790. https://doi.org/10.48550/arXiv.2208.04790

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. cer135 is a rpb-2::GFP(delta)piRNA::AID::3xFLAG tag inserted into the endogenous rpb-2 locus. This strain allows auxin-dependent disruption of RNA polymerase II with dose-dependent lifespan shortening. Reference: Oswal N, et al. PLoS Comput Biol. 2022 Sep 30;18(9):e1010415. PMID: 36178967.

byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted (line A). Integration site not mapped. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs162 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line A). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs162 [rab-3p::F3(delta)K280(I277P)(I308P) + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 anti-aggregation Tau fragment (with two I to P substitutions) and full-length Tau in all neurons. Red and green fluorescence in the pharynx due to the co-injection markers. The F3/2P fragment is not able to nucleate aggregation of full length Tau. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Worms have severe locomotion defect and slow growth. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. F3 pro aggregation fragment is expressed at low levels (line B); hard to detect by western blot. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Tau anti-aggregation double transgenic line generated by crossing byIs194 x bkIs10. Normal locomotion. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line B). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 pro-aggregation Tau fragment and full-length Tau in all neurons. Worms have severe locomotion defect and slow growth. Red and green fluorescence in the pharynx due to the co-injection markers. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Derived by additional outcrossing of BR5485. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.

No delta 12 fatty acid desaturase activity. Slow growing. Unc. Dpy. Cold sensitive - maintain at 20C or higher.

ola511 is aCRISPR-engineered allele deleting a conserved sorting motif in ATG-9, causing a 2- to 3-fold decrease in LGG-1-containing puncta (and therefore autophagosomes) in the AIY neurites. Reference: Yang S, et al. Neuron. 2022 Mar 2;110(5):824-840.e10.

kyIs150 [tax-2(delta)::GFP + lin-15(+)]. sax-1 is temperature-sensitive. ky491 was isolated by PCR from a deletion library. [NOTE: (12/29/2020) This strain has been found to actually be carrying the ky491 deletion allele of sax-1, not the ky211 point mutation as previously reported.] ky491 is a 1263 bp deletion in sax-1 (left flanking sequence: atgaagcccagg ctgtgaataaattgaatg, right flanking sequence: ccaatcacagtcagcctccgataaaatgtc). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

rdIs4 [ehn-3a::Venus(delta)]. Temperature-sensitive. Must be maintained at 15°C to produce progeny. Strain develops as hermaphrodites at 15°C (some animals are intersex with male tails), and develops as XX pseudomales at 25°C. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.

rdIs4 [ehn-3a::Venus(delta)]. Slightly Egl. Male lethal. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.

Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.

xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx384 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD) + rol-6(su1006)]. Rollers. Rollers express HMR-1 intracellular domain pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

xnIs371 [pie-1p::GFP::pac-1(1-574) + unc-119(+)]. xnEx385 [hsp16p::HA::phplc1(delta)1::hmr-1(ICD-M) + rol-6(su1006)]. Rollers. Rollers express mutated HMR-1 intracellular domain (unable to bind catenins) pan-cortically in cells upon heat shock. Maintain at 15C or 20C to prevent leaky expression of heat shock transgene. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.

unc-70(cas1050) removes nine amino acids (H590-L598) in the SCA5-associated deletion in ?-spectrin and inserts GFP at N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.

RNAi-capable OP50 strain. Tetracycline & Chloramphenicol resistant. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1. Standard OP50 (CGC) was rendered RNAi competent through two modifications by phage transduction. The OP50 RNase III (rnc) allele was replaced with the deletion allele (rnc14::?Tn10) found in HT115(DE3), and a genomically encoded IPTG-inducible T7 RNA polymerase (lacz?A::T7pol camFRT) was introduced. Reference: Neve IAA, et al. G3 (Bethesda). 2019 Nov 11. pii: g3.400741.2019.

huIs4 [hsp-16.2p::pop-1(delta N) + rol-6(su1006)]. Rollers. Truncated pop-1 fragment encoding delta N-POP-1(45-438) driven by heat-shock promotor hsp-16.2. Reference: Korswagen et al. (2000) Nature 406: 527-32.

huIs7 [hsp-16.2p::Myc::bar-1(delta N) + mec-7p::GFP + dpy-20(+)]. Muv. Posterior migration of the QR descendants. Reference: de Groot et al. (2014) Science Signal. Ra26.

kasIs9 [snb-1p::(delta)C9 ubi + myo-2::GFP]. The transgene has the snb-1 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: https://pubmed.ncbi.nlm.nih.gov/34654821/

kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821

cpIs56 [mex-5p::TagRFP-T::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpEx25 [mrck-1(delta CRIB)::YPet + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. YPet-tagged MRCK-1 truncated upstream of the CRIB domain to inhibit binding to CDC-42. Generated in N2 background. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

cpIs53 [mex-5p::GFP-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpIs54 [mex-5p::mKate::PLC(delta)-PH(A735T)::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpIs55 [mex-5p::mCherry-C1::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

cpIs64 [mex-5p::mYPet::PLC(delta)-PH::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

luc28 removes mir-791 binding sites in the cah-3 3'UTR. luc28 worms show less response towards a gradual increase in CO2 concentration from 0-5% as compared to N2 animals. Reference: Drexel T, et al. Genes Dev. 2016 Sep 15;30(18):2042-2047.

Bacteria. NJF01 originates from E. coli ET505 (F-, lambda- lysA0::Tn10 IN(rrnD-rrnE)1), modified with DE3 and (delta)rnc-38. The E. coli is lysine auxotroph and resistant to kanamycin and tetracycline. IPTG induces expression of the T7 polymerase. Grow at 37 °C on LA plates or in LB liquid medium. Reference: Fredens J, et al. Nat Methods. 2011 Aug 28;8(10):845-7.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1518 [LoxP::UAS 11X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1515 [LoxP::mec-4p::GAL4-QF::FRT3] IV. RMCE derived single copy UAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p GAL-4-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1551 [LoxP::mec-4p::QF::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1543 [LoxP::tetO 7X::(delta)mec-7p::(delta)mec-7p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1548 [LoxP::mec-4p::rtetR-L-QF::FRT3] IV. RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet ON mec-4p rtetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1554 [LoxP::mec-4p::QF2::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF2 driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1519 [LoxP::tetO 7X:: (delta)pes10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSI1560 [LoxP::mec-4p::tetR-L-QF::FRT3] IV.RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet OFF mec-4p tetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. TPR domain deleted in the endogenous ogt-1 locus using CRISPR/Cas9; Sanger sequence confirmed. The TPR domain deletion (128 aa - 583 aa) ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Defective gpdh-1p::GFP induction in the hypodermis and intestine during hypertonic stress. Constitutive col-12p::DsRed expression. Impaired adaptation to hypertonic stress. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

TPR domain deleted in the endogenous ogt-1 locus tagged with C-terminal GFP. The TPR domain deletion spans 128 aa - 583 aa. OGT-1(delta-TPR)::GFP is expressed ubiquitously in somatic tissues with a nuclear localization. The TPR domain deletion ablates the O-GlcNAcylation activity of OGT-1 as measured by the RL2 O-GlcNAc antibody. Sanger sequence confirmed. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drSi4 [vha-6p::3XFLAG::pgp-3/CFTR(delta F508)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with significantly diminished expression as compared to drSi2. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR with F508 deleted (TIKENII_G). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.

otEx5021 [lsy-6(fosmid - delta 300 bp 3')::GFP + ttx-3::mCherry]. Maintain by picking animals with mCherry expression in the AIY neurons.

otEx5022 [lsy-6(fosmid - delta 150 bp 3') + ttx-3::mCherry]. otIs3 [gcy-7p::GFP + lin-15(+)] V. Maintain by picking animals with mCherry expression in the AIY neurons. Fosmid with 150 bp deletion does not rescue ASE asymmetry.

otEx5027 [lsy-6(fosmid - delta 3 kb 3')::YFP + ttx-3::mCherry]. Maintain by picking animals with mCherry expression in the AIY neurons.

otIs386 [lsy-6(fosmid - delta 150 bp 3')::GFP + ttx-3::mCherry].

otEx4963 [lsy-6p(fosmid delta 150bp downstream)::GFP + ttx-3:mCherry]. Maintain otEx4963 by picking animals with mCherry in the AIY neurons. otIs306 [hsp-16.2::che-1::3xHA + rol-6(su1006)]. Rollers.

otIs39 [unc-47(delta)::GFP + lin-15(+)]. Expressed in RMEL/R, AVL, RIS, DVB, PVT and unidentified amphid sensory neuron pair.