Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RAF5 C. elegans cey-1(rrr12) II. Show Description
Slightly pale appearance. Reference: Arnold A, et al. Nucleic Acids Res. 2014 Dec 1;42(21):13353-69.
NL728 C. elegans cey-1(pk81) II. Show Description
Tc1 allele.
VC1310 C. elegans cey-1(ok1805) II. Show Description
F33A8.3. Superficially wild type. External left primer: CCGTTTCTCGAAAGTGCTTC. External right primer: TACACTGACCGCTGCTCATC. Internal left primer: AACCGGAGAAGGAGAAGCTC. Internal right primer: GGTCAGCTTACACACTCGCA. Internal WT amplicon: 2614 bp. Deletion size: 539 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3925 C. elegans cey-1(gk5004[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1155 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGCTCTCTTAATTACTACGAGTGTTACTGG; Right flanking sequence: CGGCTGTTACTTCGTGTGGCGCGACACAAC. See WormBase Variation gk5004 for details.
GLW51 C. elegans cey-1(utx43[mNG::3xFlag::cey-1]) II. Show Description
N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.
OP375 C. elegans unc-119(tm4063) III; wgIs375. Show Description
wgIs375 [cey-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)