Strain Information

Name GLW57   View On Wormbase
Species C. elegans
Genotypeasp-3(utx47[mNG::3xFlag::asp-3]) X.
DescriptionN-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.
MutagenCRISPR/Cas9 homologous recombination
Outcrossedx0
Made byStephen Pullman (Glow Worms '21)
Laboratory GLW
Reference N/A
Sign in or register an account if you want to order this strain.