More Fields
Strain Species Genotype
DA1006 C. elegans egl-19(ad1006) IV. Show Description
Egl. Lon. Sluggish Unc. Eat.
DA1013 C. elegans egl-19(ad1013) IV. Show Description
Weak Egl. Weak Eat.
DA1015 C. elegans egl-19(ad1015) IV. Show Description
Egl. Weak sluggish Unc.
DA695 C. elegans egl-19(ad695) IV. Show Description
Abnormal feeding. Relaxation defective. Smallish. Males don't mate. Semidominant. Previously called eat-12. See also WBPaper00002912.
DA995 C. elegans egl-19(ad995) IV. Show Description
Lon. Sluggish Unc. Egl. Eat. Rubberband.
MT1212 C. elegans egl-19(n582) IV. Show Description
Egg laying defective. Retains late stage eggs. Slow and Floppy; Long.
MT6129 C. elegans egl-19(n2368) IV. Show Description
Small. Slightly jerky movement. Terminal bulb relaxation defective. Egl-c. Cold-sensitive Pat.
RP582 C. elegans egl-19(tr69) IV. Show Description
Nemadipine-A resistant.
RP583 C. elegans egl-19(tr70) IV. Show Description
Mildly myotonic. Nemadipine-A resistant.
RP584 C. elegans egl-19(tr71) IV. Show Description
Nemadipine-A resistant.
RP585 C. elegans egl-19(tr72) IV. Show Description
Myotonic. Nemadipine-A resistant.
RP586 C. elegans egl-19(tr73) IV. Show Description
Mildly myotonic. Nemadipine-A resistant.
DA952 C. elegans egl-19(n582ad952) IV. Show Description
n582 is Egl, Lon, slow & floppy. Suppressed by ad952, which is semidominant. Strain is slightly Dpy and the pharyngeal bulb occasionally shows delayed relaxation and repolarization.
DA1031 C. elegans egl-19(n582) IV; unc-2(e55) X. Show Description
Unc. Egl, Lon, Slow and Floppy.
DA1034 C. elegans egl-19(n2368) IV; unc-2(e55) X. Show Description
Unc. Semidominant Egl-c, Sma.
DA1035 C. elegans egl-19(ad695) IV; unc-2(e55) X. Show Description
Unc. Semi-dominant Eat (TB relaxation defective).
DA929 C. elegans egl-19(n582) unc-24(e138) IV. Show Description
Unc: amber suppressible. Egl: Lon, slow and floppy.
DA939 C. elegans unc-36(e251) III; egl-19(n2368) IV. Show Description
Unc. Semidominant Egl-c, Sma.
DA944 C. elegans unc-36(e251) III; egl-19(ad695) IV. Show Description
Unc. Semidominant Eat (TB relaxation defective).
DA945 C. elegans unc-36(e251) III; egl-19(n582) IV. Show Description
Unc. Semidominant Egl, Lon, Slow and Floppy
LS706 C. elegans dys-1(cx18) I; egl-19(ad695) IV. Show Description
MT1584 C. elegans unc-8(e49) egl-19(n582) IV. Show Description
Unc. Egl.
PS3800 C. elegans egl-19(n582) IV; him-5(e1490) V; syEx468. Show Description
syEx468 [myo-3p::egl-19::GFP]. C-terminal GFP fusion. Pick GFP+ to maintain.
DA949 C. elegans bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
Blistered cuticle. Egl-Lon, slow and floppy. Unc.
RW3563 C. elegans egl-19(st556)/unc-82(e1323) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs, and Pats. Maintain by picking WT and checking for correct segregation of progeny. st556 pka pat-5.
DA1025 C. elegans vab- (ad1026); egl-19(ad1025)/bli-6(sc16) unc-24(e138) IV. Show Description
Impenetrant Vab - mostly tail; not mapped. Strain throws early larval lethals (ad1025 homozygotes) and Bli Uncs.
DA1042 C. elegans egl-19(ad1008) unc-24(e138) IV/nT1 [unc-?(n754) let-?] (IV;V) Show Description
Heterozygotes are Unc and segregate Uncs and dead eggs. ad1008 homozygotes are Pat.
DA768 C. elegans bli-6(sc16) egl-19(ad695) unc-24(e138)/nDf41 IV. Show Description
Heterozygotes are Blistered and Eat (terminal bulb relaxation defective). Heterozygotes segregate BliEat, BliEatUnc and dead eggs. ad695 previously called eat-12.
KJ487 C. elegans vha-8(jh135)/bli-6(sc16) egl-19(ad695) unc-24(e318) IV. Show Description
Heterozygotes are WT and segregate WT, Bli Unc, and dead larva. vha-8(jh135) homozygotes are larval lethal.
ST14 C. elegans mua-5(nc14)/bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.
ST17 C. elegans mua-5(nc17)/bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.
ST18 C. elegans mua-5(nc18)/bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.
ST15 C. elegans ncIs2 II; mua-5(nc15)/bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.
DA1256 C. elegans lin-15B&lin-15A(n765) X; adEx1256. Show Description
adEx1256 [egl-19::sGFP-NLS + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv. n765 is temperature-sensitive.
GLW53 C. elegans egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. Show Description
Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.