Strain Information
| Name | GLW45 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III |
| Description | C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44. |
| Mutagen | CRISPR/Cas9 homologous recombination |
| Outcrossed | x0 |
| Made by | Dan Tatulescu (Glow Worms '21) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.