Strain Information
| Name | GLW65 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | sod-2(utx53[mScarlet::3xMyc::sod-2]) I. |
| Description | N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3’ (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64. |
| Mutagen | CRISPR/Cas9 homologous recombination |
| Outcrossed | x0 |
| Made by | Param Kapoor (Glow Worms '21) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.