Strain Information
| Name | GR1373 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | eri-1(mg366) IV. |
| Description | Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366). |
| Mutagen | EMS |
| Outcrossed | x5 |
| Made by | Scott Kennedy |
| Laboratory | GR |
Sign in
or
register an account if you want to order this strain.