More Fields
Strain Species Genotype
AE501 C. elegans nhr-8(ok186) IV. Show Description
Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals.
GLW41 C. elegans nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
BN455 C. elegans bqSi294 II; bqSi453 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi453 [nhr-82p::FLP_CAI_G5D + unc-119(+)] IV. Heat shock produces green nuclei in the seam cell lineage and red nuclei elsewhere. Might still carry unc-119(ed3) III in background.
BX165 C. elegans nhr-80(tm1011) III. Show Description
HGA8001 C. elegans lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Pick animals with red pharynx to maintain. Lifespan is comparable to wild-type. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8002 C. elegans glp-1(e2141) III; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1 alone. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8004 C. elegans daf-16(mu86) I; glp-1(e2141) III; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8005 C. elegans glp-1(e2141) III; daf-12(rh61rh411) X; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8012 C. elegans glp-1(e2141) III; daf-9(rh50) X; lynEx1. Show Description
lynEx1 [nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 15-20C. Temperature-sensitve Daf-c. Mig. Pick DsRed+ animals to maintain. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
OP357 C. elegans unc-119(tm4063) III; wgIs357. Show Description
wgIs357 [nhr-84::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP421 C. elegans unc-119(tm4063) III; wgIs421. Show Description
wgIs421 [nhr-82::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP422 C. elegans unc-119(tm4063) III; wgIs422. Show Description
wgIs422 [nhr-82::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP460 C. elegans unc-119(tm4063) III; wgIs460. Show Description
wgIs460 [nhr-80::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
OP539 C. elegans unc-119(tm4063) III; wgIs539. Show Description
wgIs539 [nhr-85::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
PY1463 C. elegans oyEx45. Show Description
oyEx45 [nhr-82::GFP + coelomocyte::GFP]. N2 line injected. Maintain by picking GFP+.
RB1416 C. elegans nhr-83(ok1613) V. Show Description
F48G7.3. Homozygous. Outer Left Sequence: GCAAATGAGCATCAAGTCCA. Outer Right Sequence: TTTTTCTTTCAGCTCCCGAA. Inner Left Sequence: GGCTTTGTCGATCAGATGGT. Inner Right Sequence: ATCATTTTCGTCAAGCGGTC. Inner Primer PCR Length: 3189 bp. Deletion Size: 773 bp. Deletion left flank: GCAAGCATCCTCGGGCGGCCTGAACTAATT. Deletion right flank: TTTTTAAATTCAGATTTCTCCTTGCCGGGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1661 C. elegans nhr-85(ok2051) I. Show Description
W05B5.3. Homozygous. Outer Left Sequence: AGACATCTGCCGAAGTCGAT. Outer Right Sequence: TTTGTTCGTTCCGAGAATCC. Inner Left Sequence: CGAACATCAGCCAACAGAGA. Inner Right Sequence: ACATTTGGTGAAGGGAGCAG. Inner Primer PCR Length: 3239 bp. Deletion Size: 2433 bp. Deletion left flank: CTTCTAAGTTTTGTTGGCCTAGAAAAAGCT. Deletion right flank: TATGAGCATCCAAATGTAAGTAAGATTTCT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB921 C. elegans nhr-84(ok792). Show Description
T06C12.7. Homozygous. Outer Left Sequence: AGCTCGAGGAAGTTGACCTG. Outer Right Sequence: GTGTGGTTGTGTCTGCTCGT. Inner Left Sequence: GCGAGCTTCATCATCTCCTC. Inner Right Sequence: TTTCGGGCAATTTTCTCAAC. Inner Primer WT PCR product: 3014. Deletion size: 1171 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
STE70 C. elegans nhr-80(tm1011) III. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
STE72 C. elegans nhr-80(tm1011) III; nhr-66(ok940) IV. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
STE73 C. elegans nhr-80(tm1011) III; nhr-13(gk796) V. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
VC1557 C. elegans nhr-86(gk717) V. Show Description
Y40B10A.8. External left primer: AACCCAAAAGTTGCATGAGG. External right primer: AAAATTGGCCAGAAATGACG. Internal left primer: TCTGGCTTGATTTCTCGCTT. Internal right primer: CGCATGAGAACTGCAAGAAG. Internal WT amplicon: 1750 bp. Deletion size: 445 bp. Deletion left flank: AAAATTCAAAAAATTTTCTAAGTTTTATAT. Deletion right flank: AATAATTATTTTAACTCACTCGCAGTAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2027 C. elegans nhr-87(gk1283) IV. Show Description
Y41D4B.7. External left primer: GAAACCACAAATTACCCCCA. External right primer: AACCACATTTCGGCTGTTTC. Internal left primer: CACTTCATAGTGTGGGCGTG. Internal right primer: AGGATTCCGATTGACCTTCC. Internal WT amplicon: 2253 bp. Deletion size: 1371 bp. Deletion left flank: AAGTGACGTCACACTTCATAGTGTGGGCGT. Deletion right flank: ATAACTTACAGAGTGATGAAAGGAACGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VL220 C. elegans unc-119(ed3) III; wwEx52. Show Description
wwEx52 [nhr-86p::GFP + unc-119(+)]. Maintain by picking superficially wild-type GFP+ worms. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.
VL491 C. elegans nhr-86(tm2590) V. Show Description
Increased Nile Red and Oil-Red-O staining. Him. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.
VL505 C. elegans unc-119(ed3) III; wwIs22. Show Description
wwIs22 [nhr-86p::nhr-86(ORF)::GFP + unc-119(+)]. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.
VL510 C. elegans nhr-86(tm2590) V; wwEx52. Show Description
wwEx52 [nhr-86p::GFP + unc-119(+)]. Him. Maintain by picking superficially wild-type GFP+ worms. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.
VL584 C. elegans nhr-86(tm2590) V; wwIs22. Show Description
wwIs22 [nhr-86p::nhr-86(ORF)::GFP + unc-119(+)]. Him. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.