Strain Information
| Name | GLW89 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | ubql-1(utx69[mScarlet-I-C1::3xMyc::ubql-1]) I. |
| Description | N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Frankie Zelasko (Glow Worms '22) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.