| BC16094 |
C. elegans |
dpy-5(e907) I; sEx16094. Show Description
sEx16094 [rCes F52C9.8a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). |
|
| HA759 |
C. elegans |
pqe-1(rt13) III; rtIs11 V. Show Description
rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC. |
|
| RB1611 |
C. elegans |
lin-17(os160) I; pqe-1(ok1983) III. Show Description
lin-17(os160) identified and reported by Hitoshi Sawa (personal communication). Phenotype is Egl. Bivulva. Psa (Phasmid socket absent). F52C9.8. Homozygous. Outer Left Sequence: GAGCACAGCACAGATGAAGC. Outer Right Sequence: ATGGCATTTTCGCAAGAAAC. Inner Left Sequence: CCTTCTAACGCTTTACCCCC. Inner Right Sequence: GTCCAGTGGATCCGAGTTGT. Inner Primer PCR Length: 3247 bp. Deletion Size: 1330 bp. Deletion left flank: ACATACTGGAGCTGCTCTGCTTCTCGAATG. Deletion right flank: TGGCGCCGAATACGATTTTGATTAGCGCGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| GLW85 |
C. elegans |
pqe-1(utx65[mScarlet-I-C1::3xMyc::pqe-1]) III. Show Description
N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84. |
|