More Fields
Strain Species Genotype
OH14892 C. elegans daf-3(ot875[daf-3::GFP::3xFlag]) X. Show Description
Superficially wildtype. GFP tag inserted into endogenous daf-3 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
OH14896 C. elegans daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID]) X. Show Description
Superficially wildtype. CRISPR/Cas9-engineered AID conditional daf-3 allele. Reference: Aghayeva et al., submitted
CB1376 C. elegans daf-3(e1376) X. Show Description
Dauer defective. Non-crowder. M-MATING++++ >30%WT.
RB2589 C. elegans daf-3(ok3610) X. Show Description
F25E2.5 Homozygous. Outer Left Sequence: ctaattgccggaatcgaaaa. Outer Right Sequence: gacacttgatggccggttac. Inner Left Sequence: cgatttgctgaatttgtgga. Inner Right Sequence: gatctttcaacgaacctacgc. Inner Primer PCR Length: 1315. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GR1311 C. elegans daf-3(mgDf90) X. Show Description
mgDf90 completely eliminates the daf-3 coding region.
OH14946 C. elegans ieSi57 II; daf-7(e1372) III; daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
TY3886 C. elegans cuIs5 I; daf-3(e1376) X. Show Description
cuIs5 [myo-2c::GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.
CB2198 C. elegans daf-3(e1376) lon-2(e678) X. Show Description
Dauer defective. Long.
MT2214 C. elegans egl-32(n155) I; daf-3(e1376) X. Show Description
Temperature sensitive Egl. Dauer defective.
OK68 C. elegans cuIs2 IV; daf-3(mgDf90) X. Show Description
Dauer defective. cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Rollers. [NOTE: this strain was originally described as carrying daf-3(mg90), which is an old name for daf-3(mgDf90).]
VC1808 C. elegans grl-25(gk822) III; daf-3(gk3129) X. Show Description
This strain is homozygous for a deletion (gk822) in ZK634.8, detectable by PCR using the following primers. External left primer: GCATCATTCTTTCAGTCGCA. External right primer: TGAGCTCGACGATGAATCAC. Internal left primer: CCACGTTTCGTCATTCCTCT. Internal right primer: GAGGATTCACCACCTCCTGA. Internal WT amplicon: 1922 bp. Deletion size: 1185 bp. Deletion left flank: GCTGCGGAGGTGGCGGAGGATGTGCTCCAC. Deletion right flank: AAACATATCAACGAAGATTACATTATTCAG. Validation: gk822 passed by CGH. Other deletion (gk3129) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1985 C. elegans F47G4.6(gk1056) I; daf-3(gk3330) X. Show Description
This strain is homozygous for a deletion (gk1056) in F47G4.6, detectable by PCR using the following primers. External left primer: CGCTTCTCCTGAGGTAGTGG. External right primer: GGACACTTCGAACCGGATTA. Internal left primer: ACGATGGATCGGTGTTTCTC. Internal right primer: AGCTGCCTAGCCTTCTCCTC. Internal WT amplicon: 1914 bp. Deletion size: 457 bp. Deletion left flank: TTAGCCTAAAAAATTTTTCCGAATTTTCTC. Deletion right flank: AGCTACCGTACTCATAAGCTACAGAGTGTA. Validation: gk1056 passed by diagnostic PCR and CGH. Other deletion (gk3330) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
PJ1271 C. elegans daf-4(m592) III; ccIs55 V; daf-3(e1376) X. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. daf-4 is temperature-sensitive and dauer formation (not body size) phenotype is suppressed by daf-3. Dauers will form only when plates are crowded, starved, and maintained at 26C. Animals are small at 25C.
AA292 C. elegans daf-36(k114) V. Show Description
Mig on low cholesterol. Single daf-c at 27C, weak Mig. Strong expression in intestine at all stages. Grow at 20C.
RW11523 C. elegans unc-119(tm4063) III; stIs11523. Show Description
stIs11523 [daf-3a::H1-wCherry + unc-119(+)].
VC3864 C. elegans daf-37(gk3829[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2622 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCATTGGGAACATCACTGATTTATCCCCG; Right flanking sequence: TCTCTCTTTATCCGTTTTCAACATTTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.