Strain Information
| Name | GLW95 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | F13E6.1(utx75[F13E6.1::mNG::3xFlag]) X. |
| Description | C-terminal tag of F13E6.1 via CRISPR/Cas9 knock-in of mNeonGreen at F13E6.1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AAATCGTGCTCTCCCAAGCA 3’; rev – 5’ CTTGTCACCTGACGGGATGT 3’. Left flank: 5' CCAGTTGCGGAGGAGGCGAAGCCAATCTCT 3' (1 silent mutation); Right flank: 5' TAAattcattcatttcacataccaatatgt 3'; sgRNA: atgaatTTAAGAGATTGGCT; Cas9/sgRNA plasmid: pGLOW26; mNG^SEC^3xFlag plasmid: pGLOW104; SEC insertion allele strain: GLW94. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Gonzalo Botello-Lins (Glow Worms '20) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.