More Fields
Strain Species Genotype
GR1366 C. elegans mgIs42. Show Description
mgIs42 [tph-1::GFP + rol-6(su1006)]. Rollers.
MT14984 C. elegans tph-1(n4622) II. Show Description
Egl. Reduced pharyngeal pumping.
MT15434 C. elegans tph-1(mg280) II. Show Description
Backcrossed tph-1(mg280) allele. cam-1 mutation was removed by crossing left and right of tph-1(mg280) using bli-2 and unc-4. Strain does not have withered tail defect and moves well.
EEG107 C.elegans tph-1(mg280) II; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. When tph-1 mutants carrying mudIs1 are exposed to blue light, the worms continue to move rather than stopping like wild-type animals. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
GR1333 C. elegans yzIs71 V. Show Description
yzIs71 [tph-1p::GFP + rol-6(su1006)] V. Rollers. tph-1 transcriptional reporter containing 3.1kb of tph-1 5’ regulatory sequence through the beginning of exon 4. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Sze JY, et al. Nature. 2000 Feb 3;403(6769):560-4.
GR1321 C. elegans tph-1(mg280) cam-1(vs166) II. Show Description
Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.
OH4134 C. elegans otIs173 III; zdIs13 IV. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP] III. zdIs13 [tph-1p::GFP] IV.
OH4138 C. elegans zdIs13 IV; wrk-1(tm1099) X. Show Description
zdIs13 [tph-1p::GFP] IV.
OH4143 C. elegans vab-1(dx31) II; zdIs13 IV. Show Description
zdIs13 [tph-1p::GFP] IV.
OH4147 C. elegans zdIs13 IV; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV.
OH4127 C. elegans zdIs13 IV; oyIs14 V; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV. oyIs14 [sra-6::GFP + lin-15(+)] V.
OH4135 C. elegans otIs173 III; zdIs13 IV; wrk-1(ok695) X. Show Description
otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP]. zdIs13 [tph-1p::GFP] IV.
OH4144 C. elegans vab-1(dx31) II; zdIs13 IV; wrk-1(ok695) X. Show Description
zdIs13 [tph-1p::GFP] IV.
HZ66 C. elegans sop-2(bp186) II; him-5(e1490) bxIs16 V. Show Description
bxIs16 [cat-2::YFP + tph-1::CFP]. Temperature sensitive: lethal at 25C. Maintain at 20C.
HZ67 C. elegans him-5(e1490) bxIs16 V; sor-3(bp185) X. Show Description
bxIs16 [cat-2::YFP + tph-1::CFP]. Temperature sensitive: lethal at 25C. Maintain at 20C.
JY190 C. elegans osm-9(yz6) IV. Show Description
Downregulation of tph-1::GFP expression in the ADF neurons. CORRECTION: The yz6 allele had been erroneously listed as y26 in our database.
JY243 C. elegans ocr-2(yz5) IV. Show Description
Downregulation of tph-1::GFP expression in the ADF neurons.
JY359 C. elegans lim-4(yz12) X. Show Description
Down regulation of tph-1::GFP expression in the ADF neurons.
LX837 C. elegans vsIs45. Show Description
vsIs45 [tph-1::GFP]. tph-1::GFP in vsIs45 is expressed exclusively in the NSM neurons in larvae and NSM + HSN in adults, whereas other tph-1::GFP reporters are also expressed in other serotonergic neurons; can be used to image NSM development and for FACS isolation of NSM from L1s. Reference: Nelson JC, Colon-Ramos DA. J Neurosci. 2013 Jan 23;33(4):1366-76.
NFB1720 C. elegans tph-1(vlc46[tph-1::T2A::mNeonGreen]) II. Show Description
mNeonGreen tag inserted into endogenous tph-1 locus. Upstream flanking sequence: CTCTCCGCTCAGACATCAACCTGCTCGCCGGAGCTCTCCACTACATCCTG. Downstream flanking sequence: TAGTTTGAGTTTCCGTGTTTTTTATTTTTTTTATTTGGTTTCTGCTTTCT. Guide sequence: GTAGTTTGAGTTTCCGTGTT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NFB509 C. elegans zdIs13 IV; vlcEx284. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su10006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.
OH12495 C. elegans otIs517. Show Description
otIs517 [tph-1(fosmid)::SL2::YFP::H2B + ttx-3::mCherry]. Fosmid-based tph-1 reporter expresses YFP in NSM, ADF, and HSN neurons, as well as in R1B, R3B, and R9B (in males). Adult animals roll, though for reasons unknown.
OH8014 C. elegans zdIs13 IV; otEx3567. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3567 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH8015 C. elegans zdIs13 IV; otEx3568. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3568 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 2.
OH8016 C. elegans zdIs13 IV; otEx3569. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3569 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 3.
SK4013 C. elegans zdIs13 IV. Show Description
zdIs13 [tph-1p::GFP] IV. Transcriptional tph-1 reporter. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94.
AGK192 C. elegans unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
AGK640 C. elegans zdIs13 IV; pak-1(ok448) X; armEx252. Show Description
zdIs13 [tph-1p::GFP] IV. armEx252 [dpy-7p::pak-1::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx252 rescues the pak-1(ok480) HSN undermigration phenotype. pak-1::tagRFP is expressed in the hypodermal tissue throughout development and adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AGK650 C. elegans daf-16(mu86) I; zdIs13 IV; armEx257. Show Description
zdIs13 [tph-1p::GFP] IV. armEx257 [dpy-7p::daf-16b::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx257 rescues the daf-16(mu86) HSN undermigration phenotype. dpy-7p::daf-16b::tagRFP expression is localized to nuclei in hypodermal tissue during the comma, 1.5 and 2-fold stages, becoming cytoplasmic or perinuclear by the 3-fold stage and persisting into adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
BN499 C. elegans bqSi294 II; bqSi488 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi488 [tph-1p::FLP D5 + unc-119(+)] IV. Heat shock produces green nuclei in serotonin-producing neurons and red nuclei elsewhere.
CF3166 C. elegans muEx473. Show Description
muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
CF3649 C. elegans muIs209. Show Description
muIs209 [myo-3p::kin-19::tagRFP + tph-1p::GFP]. KIN-19::tagRFP aggregates with age in body-wall muscles. Animals have reduced thrashing compared to controls. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059. David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
DCD13 C. elegans uqIs9. Show Description
uqIs9 [myo-2p::rho1::tagRFP + tph-1p::GFP]. RHO-1::tagRFP aggregates in pharyngeal muscles. Animals have impaired pharyngeal pumping. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059.
EEG108 C. elegans mod-5(n822) I; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
EEG98 C. elegans mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
JPS617 C. elegans vxIs591. Show Description
vxIs591 [tph-1p::GFP::unc-54 3'UTR]. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
JPS809 C. elegans vxSi808 X; vxIs591. Show Description
vxSi808 [rab-3p::APP::mCherry::unc-54 3'UTR] X. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Single-copy insertion of human APP transgene tagged with mCherry expressed throughout the nervous system, visible along ventral nerve cord, head, tail, and other neurons. GFP expression in all serotonergic neurons. References: Yi B, et al. 2017 J Neurochem 140(4): 561-575. PMID: 27926996. Mondal et al. 2018 ACS Chem Neurosci. DOI: 10.1021/acschemneuro.7b00428 PMID: 29426225
JPS844 C. elegans vxIs824; vxIs591. Show Description
vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgene driving expression of human APOE4 throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in up to 60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
JPS845 C. elegans vxIs823 II; vxIs824; vxIs591. Show Description
vxIs823 [rab-3p::APP::mCherry::unc-54 3'UTR] II. vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgenes driving expression of human APOE4 and human APP throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in >60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
JVR406 C.elegans jerEx30. Show Description
jerEx30 [ddr-2p::BiFC1 (EGFH1-LINK-SYN) + tph-1p::BIFC2 (SYN-EGFH2) + rol-6(su1006)]. Pick Rollers to maintain. a-Synuclein BiFC transfer strain is a model to investigate neuron-to-neuron ?-syn transfer. Reference: Tyson T, et al. Sci Rep. 2017 Aug 8;7(1):7506.
LX960 C. elegans lin-15B&lin-15A(n765) X; vsIs97. Show Description
vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab].
LX967 C. elegans lin-15B&lin-15A(n765) vsIs103 X. Show Description
vsIs103 [tph-1p::RFP + snb-1::GFP + lin-15(+)] X. RFP expression in HSN and NSM neurons.
LX975 C. elegans vsIs13 IV; lin-15B&lin-15A(n765) X; vsIs97; vsIs100. Show Description
vsIs13 [pes-10p::GFP + lin-15(+) IV. GFP expression in six VC neurons and posterior intestine. vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab]. vsIs100 [myo-3p::CFP + lin-15(+)]. CFP expression in VMs. Additional background expression seen as punctate nucleolar fluorescence along the ventral side of the worm (also present in wild-type).
LX993 C. elegans lin-15B&lin-15A(n765) X; vsIs108. Show Description
vsIs108 [tph-1p::RFP + unc-13::GFP + lin-15(+)] X. RFP expression in HSN and NSM neurons.
NFB2468 C. elegans zdIs13 IV; vlcEx1288. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NFB2471 C. elegans zdIs13 IV; vlcEx1290. Show Description
zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
OH7235 C. elegans zdIs13 IV; otEx3154. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3154 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 1.
OH7236 C. elegans zdIs13 IV; otEx3155. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3155 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 2.
OH7237 C. elegans zdIs13 IV; otEx3156. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3156 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 3.
OH7251 C. elegans zdIs13 IV; otEx3163. Show Description
zdIs13 [tph-1p::GFP] IV. otEx3163 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 1.