B0478.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

muEx329 [jnk-1::GFP + myo-3p::RFP]. Pick RFP+ to maintain.

N-terminal tag of JNK-1 via CRISPR/Cas9 knock-in of mNeonGreen at jnk-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' cagcaagttaaagtgtgtgatcctgtgcac 3'; Right flank: 5' ATGGAGGAACGATTATCCACAACATCATCG 3’; gRNA: gtgtgatcctgtgcacATGG; Cas9/sgRNA plasmid: pGLOW114a; mNG^SEC^3xFlag plasmid: pGLOW116; SEC insertion allele strain: GLW76.

lpIs1 [jnk-1(+) + rol-6(su1006)]. Rollers. Over-expresses jnk-1(+) with rol-6. Shows life span extension. Integration of lpEx1.

lpIs2 [jnk-1(+) + rol-6(su1006)]. Over-expresses jnk-1(+) with rol-6. Shows life span extension. Integration of lpEx1. Rollers.