Strain: AA1 Species: Caenorhabditis elegans Genotype: daf-12(rh257) X. Description: daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Occasional abnormal dauers under exhausted conditions. Mutagen: EMS Outcrossed: x Made by: Adam Antebi Received: 10/23/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA10 Species: Caenorhabditis elegans Genotype: daf-12(rh286) X. Description: Weak heterochronic phenotypes in seam, intestine, somatic gonad. Class V allele. Mutagen: EMS Outcrossed: x4 Made by: Adam Antebi Received: 10/23/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA107 Species: Caenorhabditis elegans Genotype: nhr-48(ok178) X. Description: ZK662.3 Homozygous. No obvious phenotype. Outer left primer sequence: TCTGAAGTTTGTGAGCCGTG. Outer right primer sequence: AGCGCCTAGATGAGCAACAT. Inner left primer sequence: TCCGTTGAATGCCATCTGTA. Inner right primer sequence: GGACGATGCACATGAGTTTG. Inner primer PCR product length: 3324 bp. Deletion size: 1956 bp. Mutagen: UV/TMP Outcrossed: x2 Made by: Adam Antebi Received: 08/19/03 Massachusetts General Hospital, Charlestown, MA ----------------------------------------------------------------------------- Strain: AA120 Species: Caenorhabditis elegans Genotype: dhIs26. Description: dhIs26 [daf-12a::GFP + lin-15(+)]. DAF-12::GFP localized primarily in nucleus, except during mitosis. Expressed widely in most cells including tissues modified for dauer formation or by stage from embryo to adult, but most elevated and widespread during L2. Mutagen: UV Outcrossed: x3 Made by: C. Kober-Eisermann Received: 03/23/07 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA18 Species: Caenorhabditis elegans Genotype: daf-12(rh61rh412) X. Description: daf-d. Weak heterochronic phenotypes in seam, somatic gonad and intestine. Class III allele. Mutagen: Spontaneous Outcrossed: x Made by: Adam Antebi Received: 11/03/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA277 Species: Caenorhabditis elegans Genotype: lin-15B&lin-15A(n765) X; dhIs64. Description: dhIs64 [daf-9p::daf-9::GFP + lin-15(+)]. Mutagen: Outcrossed: x Made by: Antebi Lab Received: 01/11/13 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA278 Species: Caenorhabditis elegans Genotype: dhIs59. Description: dhIs59 [Topo::daf-9::GFP + lin-15(+)]. Perinuclear expression in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAV and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background. Mutagen: UV Outcrossed: x3 Made by: C. Kober-Eisermann Received: 03/23/07 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA292 Species: Caenorhabditis elegans Genotype: daf-36(k114) V. Description: Mig on low cholesterol. Single daf-c at 27C, weak Mig. Strong expression in intestine at all stages. Grow at 20C. Mutagen: Outcrossed: x Made by: Veerle Rottiers Received: 03/23/07 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA34 Species: Caenorhabditis elegans Genotype: daf-12(rh61) X. Description: daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Mutagen: EMS Outcrossed: x2 Made by: Ed Hedgecock Received: 10/23/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA408 Species: Caenorhabditis elegans Genotype: din-1(dh127) II. Description: daf-d, suppresses daf-12(rh61) daf-12(rh274) gonadal migration defects. Mutagen: EMS Outcrossed: x3 Made by: Andreas Ludewig Received: 01/28/08 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA411 Species: Caenorhabditis elegans Genotype: din-1(dh149) II. Description: daf-d, suppresses daf-12(rh61) daf-12(rh274) gonadal migration defects. Mutagen: EMS Outcrossed: x3 Made by: Andreas Ludewig Received: 01/28/08 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA426 Species: Caenorhabditis elegans Genotype: dre-1(dh99) V. Description: Precocious fusion of seam cells one stage earlier (prior to L3 molt); impenetrant gonadal migration defects; SynMig on daf-12 RNAi. Mutagen: EMS Outcrossed: x3 Made by: Nicole Fielenbach Received: 04/02/07 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA6 Species: Caenorhabditis elegans Genotype: daf-12(rh84) X. Description: daf-d. Strong heterochronic phenotypes in seam, somatic gonad, intestine. Class I allele. Mutagen: EMS Outcrossed: x2 Made by: Ed Hedgecock Received: 10/23/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA699 Species: Caenorhabditis elegans Genotype: din-1(hd36) II. Description: non-Daf. Temperature-sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults are small, clear, slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below. Mutagen: Outcrossed: x Made by: Harald Hutter Received: 01/28/08 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA776 Species: Caenorhabditis elegans Genotype: cyp-44A1(ok216) II. Description: Mutagen: UV/TMP Outcrossed: x0 Made by: OMRF Knockout Group Received: 07/22/03 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA790 Species: Caenorhabditis elegans Genotype: lin-15B&lin-15A(n765) X; dhEx343. Description: dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. Pick GFP+ to maintain. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781. Mutagen: Outcrossed: x Made by: Kerstin Neubert Received: 07/02/07 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA82 Species: Caenorhabditis elegans Genotype: daf-12(rh284) X. Description: Gonadal lead cell Mig. Weak heterochronic phenotype in intestine. Weakly daf-c at 25C. Class V allele. Mutagen: EMS Outcrossed: x2 Made by: Adam Antebi Received: 10/23/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA83 Species: Caenorhabditis elegans Genotype: daf-12(rh62rh157) X. Description: daf-d. Strong heterochronic phenotypes in seam and intestine. Weak heterochronic phenotypes in somatic gonad. Class II allele. Mutagen: Spontaneous revertant Outcrossed: x3 Made by: Ed Hedgecock Received: 10/23/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA85 Species: Caenorhabditis elegans Genotype: daf-12(rh285) X. Description: Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Weakly daf-c at 15C. Class IV allele. Mutagen: EMS Outcrossed: x2 Made by: Adam Antevi Received: 11/03/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA86 Species: Caenorhabditis elegans Genotype: daf-12(rh61rh411) X. Description: Daf-d, weak heterochronic phenotypes in seam, somatic gonad, intestine. Class III allele. Mutagen: Spontaneous revertant Outcrossed: x2 Made by: Adam Antebi Received: 10/23/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA87 Species: Caenorhabditis elegans Genotype: daf-12(rh273) X. Description: Daf-c, gonadal Mig, weak heterochronic phenotypes in intestine and seam. Class VI allele. Mutagen: EMS Outcrossed: x3 Made by: Adam Antebi Received: 10/23/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA88 Species: Caenorhabditis elegans Genotype: daf-12(rh193) X. Description: Strong heterochronic phenotypes in seam, somatic gonad, and intestine. Heterochronic phenotypes less penetrant at 15C. Weakly daf-c at 25C. Class IV allele. Mutagen: Outcrossed: x3 Made by: Adam Antebi Received: 11/03/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA89 Species: Caenorhabditis elegans Genotype: daf-12(rh274) X. Description: daf-c. Gonadal Mig. Weak heterochronic phenotypes in intestine. Class VI allele. Mutagen: EMS Outcrossed: x3 Made by: Adam Antebi Received: 11/03/00 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AA968 Species: C.elegans Genotype: nhr-8(hd117) IV. Description: Mig on low cholesterol. Reference: Magner DB, et al. Cell Metab. 2013 Aug 6;18(2):212-24. doi: 10.1016/j.cmet.2013.07.007.PMID: 23931753 Mutagen: EMS Outcrossed: x4 Made by: Harald Hutter Received: 07/11/22 Max Planck Institute, Cologne, Germany ----------------------------------------------------------------------------- Strain: AB1 Species: Caenorhabditis elegans Genotype: C. elegans wild isolate. Description: Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VII). Mutagen: Outcrossed: x Made by: Received: 09/01/84 CSIRO Adelaide, Australia ----------------------------------------------------------------------------- Strain: AB2 Species: Caenorhabditis elegans Genotype: C. elegans wild isolate. Description: Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII). Mutagen: Outcrossed: x Made by: Received: 09/01/84 CSIRO Adelaide, Australia ----------------------------------------------------------------------------- Strain: AB3 Species: Caenorhabditis elegans Genotype: C. elegans wild isolate. Description: Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII). Mutagen: Outcrossed: x Made by: Received: 09/01/84 CSIRO Adelaide, Australia ----------------------------------------------------------------------------- Strain: AB4 Species: Caenorhabditis elegans Genotype: C. elegans wild isolate. Description: Reference WBG 10(2) 140-141 and WBG 8(2) 52. Caenorhabditis elegans wild isolate. (Tc1 pattern VIII). Mutagen: Outcrossed: x Made by: Received: 09/01/84 CSIRO Adelaide, Australia ----------------------------------------------------------------------------- Strain: ABR1 Species: Caenorhabditis elegans Genotype: pha-1(e2123) III; staEx1. Description: staEx1 [T20F7.6p + pha-1(+)]. Empty vector control strain. Maintain at 25 degrees. Superficially wild-type. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56. Mutagen: Outcrossed: x0 Made by: Eric Greer Received: 04/22/10 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR14 Species: Caenorhabditis elegans Genotype: shEx34. Description: shEx34 [myo-3p::mCherry]. Pick mCherry+ to maintain. This strain serves as a control strain to ABR16. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686. Mutagen: Outcrossed: x0 Made by: Shuo Han Received: 03/30/17 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR156 Species: C. briggsae Genotype: Cbr-she-1(v35) IV; mfIs42. Description: mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863. Mutagen: Outcrossed: x0 Made by: Lauren Booth Received: 10/13/21 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR16 Species: Caenorhabditis elegans Genotype: shEx1. Description: shEx1 [ges-1p::fat-7 + myo-3p::mCherry]. Pick mCherry+ to maintain. FAT-7 over-expressing strain. ABR14 serves as a control strain for this strain. Reference: Han S, et al. Nature 2017 doi: 10.1038/nature21686. Mutagen: Outcrossed: x0 Made by: Shuo Han Received: 03/30/17 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR161 Species: C. elegans Genotype: hjIs37; ldrIs1. Description: hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715. Mutagen: Outcrossed: x6 Made by: Katharina Papsdorf Received: 08/31/23 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR212 Species: C. elegans Genotype: acd-1(sta6) delm-2(ok1822) I. Description: acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). Mutagen: Crispr/Cas9 Outcrossed: x3 Made by: Lauren Booth Received: 10/13/21 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR225 Species: C. elegans Genotype: acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Description: acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177. Mutagen: none Outcrossed: x0 Made by: Lauren Booth Received: 10/13/21 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR339 Species: C. elegans Genotype: lpin-1(wbm76[lpin-1::GFP]) V. Description: GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.] Mutagen: Crispr/Cas9 Outcrossed: x2 Made by: Carlos G Silva-García/Katharina Papsdorf Received: 08/31/23 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR4 Species: Caenorhabditis elegans Genotype: pha-1(e2123) III; staEx4. Description: staEx4 [T20F7.6p(R81Q)::T20F7.6 + pha-1(+)]. Constitutively active T20f7.6 promoter construct (CA3). Maintain at 25 degrees. Superficially wild-type with increased lifespan and stress resistance. Reference: Greer EL et al Curr Biol 2007 Oct 9;17(19):1646-56. Mutagen: Outcrossed: x0 Made by: Eric Greer Received: 04/22/10 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR5 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; staIs1. Description: staIs1 [pie-1p::GFP + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: This strain was used as the empty vector control in Greer EL et al Nature 2010 doi: 10.1038/nature09195. Mutagen: Bombardment Outcrossed: x0 Made by: Eric Greer Received: 10/11/24 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR7 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; staIs2. Description: staIs2 [pie-1p::rbr-2::GFP + unc-119(+)]. Extended longevity. Maintain under normal conditions. Reference: This strain was used as LC Ppie-1::rbr-2::GFP (#3) in Greer EL et al Nature 2010 doi: 10.1038/nature09195. Mutagen: Bombardment Outcrossed: x0 Made by: Eric Greer Received: 10/11/24 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: ABR9 Species: Caenorhabditis elegans Genotype: set-2(ok952) III; rbr-2(tm1231) IV. Description: Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195. Mutagen: Outcrossed: x Made by: Eric Greer Received: 06/17/10 STANFORD UNIVERSITY ----------------------------------------------------------------------------- Strain: AC196 Species: Caenorhabditis elegans Genotype: sao-1(ik1) V. Description: Superficially wild-type. Suppresses of aph-1(zu147). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057. Mutagen: EMS Outcrossed: x5 Made by: C. Goutte & V. Hale Received: 07/20/15 Amherst College, Amherst, MA ----------------------------------------------------------------------------- Strain: AC257 Species: Caenorhabditis elegans Genotype: ppk-3(n2668) X. Description: Growth retardation, enlarged vacuoles (late endosomes and lysosomes) in intestine, epidermis, coelomocytes and pharynx. 27% embryonic lethality and 8% post-embryonic lethality. Mutagen: EMS Outcrossed: x8 Made by: Andrew Chisholm Received: 04/25/07 UMR7622, IBPS, Paris, France ----------------------------------------------------------------------------- Strain: AC365 Species: Caenorhabditis elegans Genotype: sao-1(ok3335) V. Description: Derived by outcrossing parental strain RB2429 six times to N2, followed by recombining flanking chromosome to the right and left by recombining on, and then off rol-4(sc8) and unc-76(e911). Reference: Hale VA, et al. Genetics. 2012 Mar; 190(3): 1043-1057. Mutagen: EMS Outcrossed: x13 Made by: Valerie Hale Received: 07/20/15 Amherst College, Amherst, MA ----------------------------------------------------------------------------- Strain: AC68 Species: Caenorhabditis elegans Genotype: unc-29(e1072) aph-2(zu181)/unc-13(e1091) lin-11(n566) I. Description: Heterozygotes are WT and segregate WT, Unc Egls, and dead eggs. Mutagen: Tc1 Outcrossed: x10 Made by: Received: 11/09/00 Amherst College, Amherst, MA ----------------------------------------------------------------------------- Strain: AD186 Species: Caenorhabditis elegans Genotype: egg-1(tm1071) III. Description: Temperature sensitive sterile. Maintain at 20C. Fertility is <10% of WT at 25C. Mutagen: UV/TMP Outcrossed: x>3 Made by: S. Mitani Received: 01/17/06 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD189 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; asIs2. Description: asIs2 [pie-1p::GFP::egg-1 + unc-119(+)]. Oocyte membranes are GFP+. Mutagen: Microparticle Bombardment Outcrossed: x Made by: Received: 03/27/06 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD200 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; asIs1. Description: asIs1 [pie-1p::GFP::egg-3 + unc-119(+)]. Mutagen: Outcrossed: x3 Made by: Rika Maruyama Received: 03/20/08 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD213 Species: Caenorhabditis elegans Genotype: spe-19(eb52) V; asEx83. Description: asEx83 [spe-19(+) + myo-3p::GFP]. Pick GFP+ to maintain. asEx83 contains 7.3kb genomic fragment including spe-19 (Y113G7A.10) and 850bp of upstream sequence. Transgene rescues spe-19(eb52) sperm activation defect. GFP+ hermaphrodites are fertile. non-GFP hermaphrodites are sterile. All males are fertile. Mutagen: EMS Outcrossed: x Made by: Bryan Geldziler Received: 02/12/16 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD226 Species: Caenorhabditis elegans Genotype: egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Description: Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Mutagen: Outcrossed: x3 Made by: Japanese KO Consort. Received: 03/20/08 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD238 Species: Caenorhabditis elegans Genotype: asIs2. Description: asIs2 [pie-1p::mCherry::egg-3]. Mutagen: Outcrossed: x3 Made by: Rika Maruyama Received: 03/20/08 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD265 Species: Caenorhabditis elegans Genotype: nnIs2. Description: nnIs2 [pie-1p::GFP::chs-1 + unc-119(+)]. Mutagen: Outcrossed: x3 Made by: Rika Maruyama Received: 06/25/08 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD266 Species: Caenorhabditis elegans Genotype: egg-4(tm1508) egg-5(ok1781) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Description: Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1508 ok1781 homozygotes (maternal sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Parry JM, et al 2009 Current Biology 19(20):1752-7. Mutagen: Outcrossed: x Made by: Jean Parry Received: 12/15/09 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD271 Species: Caenorhabditis elegans Genotype: spe-38(eb44) I; him-5(e1490) V; asEx78. Description: asEx78 [spe-38p::spe-38(cDNA)::spe-38 3'UTR + myo-3p::GFP]. Pick GFP+ to maintain. GFP+ worms are fertile; animals that have lost the array are sterile. Mutagen: Outcrossed: x Made by: G. Singaravelu Received: 06/01/11 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD281 Species: Caenorhabditis elegans Genotype: spe-45(as38) IV; him-5(e1490) V. Description: Him. Temperature-sensitive sterile. Small brood size even at permissive temperatures; pick fertile animals and maintain at 15C. Worms lacking spe-45 function produce morphologically normal and motile sperm that cannot fuse with oocytes despite direct contact in the reproductive tract. spe-45 hermaphrodites and males are subfertile at 16C and sterile at 25C. Reference: Singaravelu G, et al. Current Biology 2015. http://dx.doi.org/10.1016/j.cub.2015.10.055 Mutagen: EMS Outcrossed: x10 Made by: G. Singaravelu Received: 01/20/16 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: AD292 Species: C. elegans Genotype: spe-51(as39) IV; him-5(e1490) V; asEx95. Description: asEx95 [T22B11.1(genomic) + myo-3p::GFP]. Pick GFP+ animals to maintain. as39 is a non-conditional allele of spe-51. Mutant hermaphrodites and males are severely subfertile due to a sperm defect. The extrachromosomal array asEx95 effectively rescues the fertility defect. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427. Mutagen: EMS Outcrossed: x>3 Made by: Xue Mei Received: 08/15/23 St. John's University ----------------------------------------------------------------------------- Strain: AD294 Species: C. elegans Genotype: cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Description: Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314. Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Amy Maddox Received: 09/24/21 University of Delaware ----------------------------------------------------------------------------- Strain: AD296 Species: C. elegans Genotype: spe-51(syb2737[spe-51::mNeonGreen]) IV; him-5(e1490) V. Description: mNeonGreen tag inserted into the endogenous spe-51 locus. Him. Reference: Mei X, et al. Curr Biol. 2023 Jul 3;S0960-9822(23)00780-7. doi: 10.1016/j.cub.2023.06.029. PMID: 37453427. Mutagen: Outcrossed: x1 Made by: Xue Mei Received: 08/15/23 St. John's University ----------------------------------------------------------------------------- Strain: AD319 Species: C. elegans Genotype: spe-38(syb6556[spe-38::wrmScarlet-I]) I; him-5(e1490) V. Description: wrmScarlet-I tag inserted into endogenous spe-38 locus. Him. wrmScarlet-I expression labels membranous organelles (MOs) in the sperm. Reference: Zuo Y, et al. Biomolecules. 2023; 13(4):623. https://doi.org/10.3390/biom13040623 Mutagen: Outcrossed: x3 Made by: SunyBiotech & Yamei Zuo Received: 05/22/23 Waksman Institute, Piscataway, NJ ----------------------------------------------------------------------------- Strain: ADS1002 Species: C. elegans Genotype: aeaIs10. Description: aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446 Mutagen: Outcrossed: x3 Made by: Zhen and Samuel labs Received: 12/08/21 Harvard University Physics Department ----------------------------------------------------------------------------- Strain: ADS707 Species: Caenorhabditis elegans Genotype: unc-13(s69) I; aeaIs8; hpIs728. Description: aeaIs8 [ift-20p::GCaMP6s::3xNLS + lin-15(+)]. hpIs728 [gpc-1p::wCherry + lin-15(+)]. Unc. Nuclear-localized GCaMP6s expressed in ciliated sensory neurons. Cytoplasmic wCherry expression in a subset of neurons. Derived by crossing EG9631 (unc-13) hermaphrodites with ZM10104 (aeaIs8; hpIs728) heterozygous males. Reference: Lin A, et al. bioRxiv 2022.05.27.493772; doi: https://doi.org/10.1101/2022.05.27.493772. Mutagen: N/A Outcrossed: x0 Made by: Albert Lin Received: 02/20/23 Harvard University Physics Department ----------------------------------------------------------------------------- Strain: AE501 Species: Caenorhabditis elegans Genotype: nhr-8(ok186) IV. Description: Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals. Mutagen: EMS Outcrossed: x4 Made by: Moulder/Lindblom Received: 08/30/01 Massachusetts General Hospital, Charlestown, MA ----------------------------------------------------------------------------- Strain: AF1 Species: Caenorhabditis elegans Genotype: +/szT1 [lon-2(e678)] I; dpy-8(e1321) unc-3(e151)/szT1 X. Description: Heterozygotes are WT and segregate WT, DpyUnc, dead eggs and Lon males. Maintain by picking WT. Mutagen: X-ray Outcrossed: x Made by: Fodor A Received: 05/01/81 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF13(4) Species: Oscheius akosreti Genotype: Oscheius akosreti wild isolate. Description: Isolated in Memorial Park in Madison, WI. No hermaphrodites. Lots of SDS resistant dauers. Can survive between 15-28C, but grows very slowly at 15C. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF16 Species: Caenorhabditis briggsae Genotype: C. briggsae wild isolate. Description: See WBG 7(1) 48. Isolated from soil in Ahmedabad, India. Previously called C. briggsae G16. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 02/01/82 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF25 Species: Unknown species Genotype: Unknown species wild isolate Description: Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF271 Species: Unknown species Genotype: Unknown species wild isolate Description: Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF272 Species: Unknown species Genotype: Unknown species wild isolate Description: Dark in color. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF36 Species: Panagrolaimus rigidus Genotype: Panagrolaimus rigidus wild isolate. Description: Panagrolaimus rigidus (Schneider, 1886). Males and females. Animals are long. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF40 Species: Panagrolaimus rigidus Genotype: Panagrolaimus rigidus wild isolate. Description: Panagrolaimidae: P. rigidus (Schneider, 1866). Dig themselves into the agar. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF5 Species: Oscheius sp. Genotype: Oscheius sp. wild isolate Description: Isolated in Towers Hill State Park in WI. Males are rare. No SDS resistant dauers. Animals are osmosensitive, can be dried competely and recover in water. Rhabditidae. Previously known as Rhabditis sp. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF6733 Species: Unknown species Genotype: Unknown species wild isolate. Description: Isolated in Pennsylvania. SDS resistant dauers. Males are rare. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF6840 Species: Unknown species Genotype: Unknown species wild isolate. Description: Isolated in Pennsylvania. Males are rare. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF72 Species: Mesorhabditis spiculigera Genotype: Mesorhabditis spiculigera wild isolate. Description: Mesorhabditis spiculigera. Isolated in Pennsylvania. NOTE: (06/10/2016) AF72 was originally described as Mesorhabditis miotki, but K. Kiontke has determined through morphological inspection that this is actually a strain of Mesorhabditis spiculigera. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF7340 Species: Unknown species Genotype: Unknown species wild isolate Description: Isolated in Ohio. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF78 Species: Mesorhabditis sp. Genotype: Mesorhabditis sp. wild isolate. Description: Rhabditidae: Mesorhabditis sp. Isolated in Governor Dodge State Park in South Dakota. Dark in color. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF8032 Species: Unknown species Genotype: Unknown species wild isolate Description: Isolated at Niagara Falls in Canada. SDS resistant dauers look like C. elegans predauers. Males are rare. Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AF8130 Species: Pristionchus sp. Genotype: Pristionchus sp. wild isolate. Description: Neodiplogasteridae: Pristionchus Iheritieri, Maupas, 1919. Isolated in Ontario, Canada. [9/98: Ralf Sommer has found this strain to be hermaphroditic. He had successful matings between AF8130 and PS312 Pristionchus pacificus, indicating that AF8130 is probably P. pacificus.] Mutagen: Outcrossed: x Made by: Andras Fodor Received: 08/21/95 Hungarian Academy of Science, Szeged ----------------------------------------------------------------------------- Strain: AFS205 Species: Caenorhabditis elegans Genotype: zen-4(cle5) IV. Description: Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775. Mutagen: Crispr/Cas9 Outcrossed: x4 Made by: Aaron F. Severson Received: 12/05/18 Cleveland State University, Cleveland OH, USA ----------------------------------------------------------------------------- Strain: AFS222 Species: Caenorhabditis elegans Genotype: zen-4(cle10) IV. Description: Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775. Mutagen: Crispr/Cas9 Outcrossed: x5 Made by: Aaron F. Severson Received: 12/05/18 Cleveland State University, Cleveland OH, USA ----------------------------------------------------------------------------- Strain: AG150 Species: Caenorhabditis elegans Genotype: apc-1(ar104)/unc-4(e120) bli-1(e769) II. Description: Heterozygotes are WT and segregate WT, UncBli, and Steriles which have an everted vulva. ar104 previously called evl-22 and mat-2. Mutagen: Outcrossed: x Made by: Andy Golden Received: 05/30/01 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG151 Species: Caenorhabditis elegans Genotype: cdc-25.1(nr2036)/dpy-5(e61) unc-13(e450) I. Description: Heterozygotes are WT and segregate WT, DpyUncs and adult steriles. Original deletion from Axys Pharmaceuticals. Mutagen: UV/TMP Outcrossed: x10 Made by: Ashcroft/Golden Received: 01/24/03 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG152 Species: Caenorhabditis elegans Genotype: unc-85(e1414) bli-2(e768) dpy-10(e128) II. Description: Unc and Dpy. Not Blistered: dpy-10 suppresses the appearance of the blisters. Mutagen: Outcrossed: x Made by: Andy Golden Received: 06/17/05 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG165 Species: Caenorhabditis elegans Genotype: san-1(av31) unc-13(e450) I. Description: Unc. Reduced brood size. Larval lethal, larval arrest. Steriles. Bursts at vulva. Can be maintained as a homozygote. Mutagen: EMS Outcrossed: x3 Made by: Ed Davis Received: 05/01/07 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG166 Species: Caenorhabditis elegans Genotype: mdf-2(av16) unc-17(e245) IV. Description: Reduced brood size. Reduced hatching. Slow growth. Larval lethal. Larval arrest. Bursts at vulva. Suppresses the mat-3 one-cell arrest at 25C. Mutagen: EMS Outcrossed: x3 Made by: Received: 05/09/07 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG168 Species: Caenorhabditis elegans Genotype: fzy-1(av15) unc-4(e120) II. Description: Unc. Gain-of-function allele of fzy-1. Mutagen: EMS Outcrossed: x Made by: Andy Golden Received: 06/06/07 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG171 Species: Caenorhabditis elegans Genotype: mdf-1(av19) unc-42(e270) V. Description: Unc. Previously called AG164 by the CGC. Mutagen: EMS Outcrossed: x Made by: Andy Golden Received: 05/01/07 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG175 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; avEx122. Description: avEx122 [(pAG126) lpin-1p::GFP::lpin-1::lpin-1 3'UTR + unc-119(+)]. No GFP expression detected in germline. Mutagen: Bombardment Outcrossed: x Made by: Orna Cohen-Fix Received: 07/02/09 NIH, NIDDK, Bethesda, MD ----------------------------------------------------------------------------- Strain: AG176 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; avEx123. Description: avEx123 [lpin-1p::GFP::his-58::lpin-1 3'UTR + unc-119(+)]. No GFP expression detected in germline. Mutagen: Bombardment Outcrossed: x Made by: Orna Cohen-Fix Received: 07/02/09 NIH, NIDDK, Bethesda, MD ----------------------------------------------------------------------------- Strain: AG226 Species: Caenorhabditis elegans Genotype: rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Description: nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Mutagen: Outcrossed: x10 Made by: Andy Golden Received: 09/05/13 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG247 Species: Caenorhabditis elegans Genotype: tyms-1(tm2429) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Description: Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm2429 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015). Mutagen: Outcrossed: x Made by: Abby Fuchsman Received: 03/27/15 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG248 Species: Caenorhabditis elegans Genotype: mus-101(tm1761) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Description: Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm1761 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015). Mutagen: Outcrossed: x Made by: Abby Fuchsman Received: 03/27/15 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AG400 Species: C. elegans Genotype: fasn-1(av138[fasn-1::gfp]) I. Description: Homozygous viable, gfp expression in intestine, hypodermis, developing vulva, somatic gonad. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619 Mutagen: Outcrossed: x2 Made by: Xiaofei Bai Received: 03/21/23 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: AG406 Species: C. elegans Genotype: pezo-1(av144) IV. Description: av144 is a CRISPR/Cas9 engineered deletion in the N-terminal region of pezo-1 removing exons 1–13. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809. Mutagen: Outcrossed: x0 Made by: Xiaofei Bai Received: 09/13/24 University of Florida ----------------------------------------------------------------------------- Strain: AG416 Species: C. elegans Genotype: pezo-1(av149) IV. Description: av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (27–33) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809. Mutagen: Outcrossed: x0 Made by: Xiaofei Bai Received: 09/13/24 University of Florida ----------------------------------------------------------------------------- Strain: AG50 Species: Caenorhabditis elegans Genotype: daf-7(e1372) dpy-1(e1) III. Description: Maintain at 15C. Temperature-sensitive dauer constitutive: 100% dauers at 25C, leaky at 20C. Dpy. Crowds. Mutagen: Outcrossed: x Made by: Andy Golden Received: 08/27/99 NIDDK/NIH ----------------------------------------------------------------------------- Strain: AGD1032 Species: Caenorhabditis elegans Genotype: glp-1(e2141) III; xzEx1. Description: xzEx1 [unc-54p::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x0 Made by: David Vilchez Received: 11/22/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD1033 Species: Caenorhabditis elegans Genotype: glp-1(e2141) III; xzEx3. Description: xzEx3 [unc-54p::UbG76V::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x0 Made by: David Vilchez Received: 11/22/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD1047 Species: Caenorhabditis elegans Genotype: glp-1(e2141) III; uthEx649. Description: uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C; sterile at 25C. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x0 Made by: David Vilchez Received: 04/25/14 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD1048 Species: Caenorhabditis elegans Genotype: daf-16(mu86) I; glp-1(e2141) III; uthEx649. Description: uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C; sterile at 25C. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x0 Made by: David Vilchez Received: 04/25/14 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD1101 Species: Caenorhabditis elegans Genotype: uthIs372. Description: uthIs372 [sur-5p::pat-10::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3. Mutagen: Outcrossed: x7 Made by: Nathan Baird Received: 05/28/15 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD383 Species: Caenorhabditis elegans Genotype: uthIs202. Description: uthIs202 [aak-2(intron 1)::aak-2(aa1-aa321)::Tomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. Mutagen: Outcrossed: x4 Made by: Will Mair Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD397 Species: Caenorhabditis elegans Genotype: aak-1(tm1944) III; aak-2(ok524) X; uthEx202. Description: uthEx202 [crtc-1p::crtc-1 cDNA::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. Mutagen: Outcrossed: x Made by: Will Mair Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD418 Species: Caenorhabditis elegans Genotype: uthIs205. Description: uthIs205 [crtc-1p::crtc-1::RFP::unc-54 3'UTR + rol-6(su1006)]. Mutagen: Outcrossed: x4 Made by: William Mair Received: 08/17/12 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD448 Species: Caenorhabditis elegans Genotype: uthEx488. Description: uthEx488 [crtc-1p::crtc-1 cDNA (S179A)::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. Mutagen: Outcrossed: x Made by: Will Mair Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD466 Species: Caenorhabditis elegans Genotype: uthEx222. Description: uthEx222 [crtc-1p::crtc-1 cDNA (S76A, S179A)::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. Mutagen: Outcrossed: x Made by: Will Mair Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD467 Species: Caenorhabditis elegans Genotype: uthEx490. Description: uthEx490 [aak-2 (intron 1)::aak-2(aa1-aa321 T172D)::GFP + crtc-1p::crtc-1::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. Mutagen: Outcrossed: x Made by: Will Mair Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD469 Species: Caenorhabditis elegans Genotype: uthEx492. Description: uthEx492 [aak-2 (intron 1)::aak-2(aa1-aa321 T172A)::GFP + crtc-1p::crtc-1::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. Mutagen: Outcrossed: x Made by: Will Mair Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD470 Species: Caenorhabditis elegans Genotype: uthEx493. Description: uthEx493 [crtc-1p::crtc-1 cDNA (S76A)::tdTomato + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. Mutagen: Outcrossed: x Made by: Will Mair Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD597 Species: Caenorhabditis elegans Genotype: uthEx556. Description: uthEx556 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x0 Made by: David Vilchez Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD598 Species: Caenorhabditis elegans Genotype: uthEx557. Description: uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x Made by: David Vilchez Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD614 Species: Caenorhabditis elegans Genotype: uthEx633. Description: uthEx633 [myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x0 Made by: David Vilchez Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD710 Species: Caenorhabditis elegans Genotype: uthIs235. Description: uthIs235 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3. Mutagen: Outcrossed: x2+ Made by: Nathan Baird Received: 05/29/15 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD731 Species: Caenorhabditis elegans Genotype: uthEx299. Description: uthEx299 [aak-2 (genomic aa1-aa321)::GFP::unc-54 3'UTR + myo-2p::tdTomato]. Pick animals with red pharynx to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8. Mutagen: Outcrossed: x Made by: Will Mair Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD794 Species: Caenorhabditis elegans Genotype: hsf-1 (sy441) I; uthIs225. Description: uthIs225 [sur5p::hsf-1(CT-Delta)::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3. Mutagen: Outcrossed: x2+ Made by: Nathan Baird Received: 05/28/15 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD850 Species: Caenorhabditis elegans Genotype: rmIs110; uthEx557. Description: rmIs110 [F25B3.3p::Q40::YFP]. uthEx557 [sur5p::rpn-6 + myo3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x0 Made by: David Vilchez Received: 11/22/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD851 Species: Caenorhabditis elegans Genotype: rmIs284; uthEx557. Description: rmIs284 [F25B3.3p::Q67::YFP]. uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x Made by: David Vilchez Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD866 Species: Caenorhabditis elegans Genotype: rmIs110; uthEx633. Description: rmIs110 [F25B3.3p::Q40::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x Made by: David Vilchez Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD867 Species: Caenorhabditis elegans Genotype: rmIs284; uthEx633. Description: rmIs284 [F25B3.3p::Q67::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x Made by: David Vilchez Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD885 Species: Caenorhabditis elegans Genotype: rrf-3(b26) II; fem-1(hc17) IV; uthEx633. Description: uthEx633 [myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x Made by: David Vilchez Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD886 Species: Caenorhabditis elegans Genotype: rrf-3(b26) II; fem-1(hc17) IV; uthEx557. Description: uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x Made by: David Vilchez Received: 11/22/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD926 Species: Caenorhabditis elegans Genotype: zcIs4 V; uthIs269. Description: zcIs4 [hsp-4::GFP] V. uthIs269 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. ER stress resistence. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47. Mutagen: Outcrossed: x5+ Made by: Rebecca Taylor Received: 05/28/15 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD927 Species: Caenorhabditis elegans Genotype: uthIs270. Description: uthIs270 [rab-3p::xbp-1s (constitutively active) + myo-2p::tdTomato]. Pick animals with red pharynx to maintain. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47. Mutagen: Outcrossed: x8 Made by: Rebecca Taylor Received: 09/18/13 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD945 Species: Caenorhabditis elegans Genotype: uthEx649. Description: uthEx649 [rpn-6p::tdTomato + rol-6(su1006)]. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x0 Made by: David Vilchez Received: 04/25/14 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGD946 Species: Caenorhabditis elegans Genotype: uthEx650. Description: uthEx650 [rpn-6p::tdTomato + rol-6(su1006)]. Rollers. Pick rollers to maintain array. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8. Mutagen: Outcrossed: x0 Made by: David Vilchez Received: 04/25/14 University of California Berkeley, Berkeley CA, USA ----------------------------------------------------------------------------- Strain: AGK192 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; zdIs13 IV; armIs5. Description: zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907. Mutagen: Outcrossed: x0 Made by: Cecere & Kennedy Received: 11/20/13 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK233 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; niDf199 IV; armEx58. Description: armEx58 [WRM0611aH08-Del8mer + unc-119(+)]. Pick non-Unc to maintain. This strain contains a transgenic array that expresses a derivative WRM0611aH08 fosmid. The WRM0611aH08 fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. This derivative fosmid construct lacks the upstream 8-mer motif (CTGTTTCA) next to 21U-3372. The expression of this individual 21U-RNA is lost in transgenic animals. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Mutagen: Outcrossed: x0 Made by: Cecere & Mansisidore Received: 12/16/14 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK234 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; niDf199 IV; armEx53. Description: armEx53 [WRM0611aH08 + unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. This strain contains a transgenic array that expresses the WRM0611aH08 fosmid construct. This fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. Expression of this fosmid construct in JU258 worms restores the expression of the missing 21U-RNAs in the germline, as measured by RT-qPCR. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Mutagen: Outcrossed: x0 Made by: Cecere & Mansisidore Received: 12/16/14 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK26 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; armEx5. Description: armEx5 [zfp-1(fosmid)::GFP + unc-119(+)]. Pick non-Unc to maintain. Fosmid-based zfp-1::GFP transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. Nuclear expression of zfp-1::GFP is observed ubiquitously in somatic cells in all developmental stages; high levels of GFP expression is observed in oocytes with lower levels of expression in the distal germline. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Mutagen: Outcrossed: x0 Made by: Cecere & Mansisidore Received: 11/20/13 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK280 Species: Caenorhabditis elegans Genotype: zfp-1(ok554) unc-119(ed3) III; armEx14. Description: armEx14 [PHD1-PHD2::FLAG + zfp-1(short isoform) + unc-119(+)]. Pick non-Unc animals to maintain. The fosmid-based armEx14 transgene rescues zfp-1(ok554)/nDf17 lethality. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Mutagen: Outcrossed: x0 Made by: Cecere & Mansisidore Received: 11/20/13 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK369 Species: Caenorhabditis elegans Genotype: zfp-1(ok554) III; armIs8. Description: armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Mutagen: Outcrossed: x Made by: Received: 12/16/14 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK370 Species: Caenorhabditis elegans Genotype: zfp-1(ok554) III; armIs9. Description: armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Mutagen: Outcrossed: x2 Made by: Daphne Avgousti Received: 11/20/13 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK532 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; niDf199 IV; armEx196. Description: armEx196 [mex-5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to deletion of the niDF199 locus. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Mutagen: Outcrossed: x0 Made by: Germano Cecere Received: 12/16/14 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK537 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; armEx199. Description: armEx199 [cdl-1p::cdl-1::GFP + unc-119(+)]. Pick non-Unc to maintain. Nuclear localization of CDL-1::GFP in the germline and early embryos; strong enrichement of CDL-1::GFP in the nuclei of developing oocytes. Reference: Avgousti DC, et al. EMBO J. 2012 Oct 3;31(19):3821-32. Mutagen: Outcrossed: x0 Made by: Daphne Avgousti Received: 10/11/24 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK541 Species: Caenorhabditis elegans Genotype: armSi1 II; unc-119(ed3) III. Description: armSi1 [mex5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP expression from transgene is observed in the germline. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Mutagen: Outcrossed: x0 Made by: Germano Cecere Received: 12/16/14 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK573 Species: Caenorhabditis elegans Genotype: otIs225 II; daf-18(ok480) IV; armEx218. Description: otIs225 [cat-4::GFP] II. armEx218 [unc-119p::daf-18 + unc-119p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Transgenic array expresses DAF-18 from unc-119 pan-neuronal promoter; rescues the HSN under-migration phenotype in daf-18 null mutants. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009. Mutagen: Outcrossed: x0 Made by: Lisa Kennedy Received: 12/16/13 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK587 Species: Caenorhabditis elegans Genotype: armEx227. Description: armEx227 [pak-1p::NLS::tagRFP + rol-6(su1006)]. Pick rollers to maintain. pak-1p::NLS::tagRFP is expressed primarily in the hypodermal tissue during the comma and 1.5-fold stages, and in the CAN cells at the 3-fold stage through adulthood. Expression can also be seen in additional neurons during the larval and adult stages. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009. Mutagen: Outcrossed: x Made by: Received: 12/16/13 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK640 Species: Caenorhabditis elegans Genotype: zdIs13 IV; pak-1(ok448) X; armEx252. Description: zdIs13 [tph-1p::GFP] IV. armEx252 [dpy-7p::pak-1::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx252 rescues the pak-1(ok448) HSN under-migration phenotype. pak-1::tagRFP is expressed in the hypodermal tissue throughout development and adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009. Mutagen: Outcrossed: x0 Made by: Lisa Kennedy Received: 12/16/13 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AGK650 Species: Caenorhabditis elegans Genotype: daf-16(mu86) I; zdIs13 IV; armEx257. Description: zdIs13 [tph-1p::GFP] IV. armEx257 [dpy-7p::daf-16b::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx257 rescues the daf-16(mu86) HSN undermigration phenotype. dpy-7p::daf-16b::tagRFP expression is localized to nuclei in hypodermal tissue during the comma, 1.5 and 2-fold stages, becoming cytoplasmic or perinuclear by the 3-fold stage and persisting into adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009. Mutagen: Outcrossed: x0 Made by: Lisa Kennedy Received: 12/16/13 Boston University School of Medicine, Boston, MA ----------------------------------------------------------------------------- Strain: AH102 Species: Caenorhabditis elegans Genotype: lip-1(zh15) IV. Description: Deletion allele which removes exons 2 to 6 of lip-1 (C05B10.1). Incompletely penetrant ovulation defect. Mutagen: EMS Outcrossed: x8 Made by: Thomas Berset Received: 05/21/01 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH12 Species: Caenorhabditis elegans Genotype: gap-1(ga133) X. Description: Null allele. Mutagen: Psoralen Outcrossed: x4 Made by: Alex Hajnal Received: 12/08/97 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH142 Species: Caenorhabditis elegans Genotype: zhIs4 III. Description: zhIs4 [lip-1::GFP] III. lip-1::GFP transcriptional reporter expression is upregulated in the secondary VPCs P5.p and P7.p of early L3 animals. Mutagen: Gamma Rays Outcrossed: x5 Made by: Thomas Berset Received: 05/21/01 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH159 Species: Caenorhabditis elegans Genotype: sra-13(zh13) II. Description: sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele. Mutagen: EMS Outcrossed: x8 Made by: Gopal Battu Received: 12/16/03 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH1747 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; zhIs35 I. Description: zhIs35 [let-23::GFP + unc-119(+)] I. zhIs35 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene expression is higher in this strain than in AH1779 unc-119(ed3) III; zhIs38. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341. Mutagen: Bombardment Outcrossed: x2 Made by: JM Escobar-Restrepo Received: 02/18/16 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH1779 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; zhIs38 IV. Description: zhIs38 [let-23::GFP + unc-119(+)] IV. zhIs38 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene is expressed at levels similar to endogenous LET-23. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341. Mutagen: Bombardment Outcrossed: x2 Made by: JM Escobar-Restrepo Received: 02/18/16 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH205 Species: Caenorhabditis elegans Genotype: sdn-1(zh20) X. Description: Slightly Unc. Variably Egl. zh20 is a deletion in sdn-1. The sequence of the breakpoint is: TTTGCTTCACAC//zh20//GTCGACAGGCAG. Mutagen: EMS Outcrossed: x6 Made by: Erika Frohli Received: 10/26/05 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH286 Species: Caenorhabditis elegans Genotype: unc-4(e120) ect-2(zh8) II; gap-1(ga133) X. Description: Muv and Unc. Semi-dominant mutation in ect-2 (previously called let-21). Mutagen: EMS Outcrossed: x3 Made by: Erika Frohli Received: 12/27/05 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH3437 Species: C. elegans Genotype: tln-1(zh117[gfp::tln-1]) I. Description: Wild-type morphology. Endogenous GFP reporter for tln-1. Reference: Walser M, et al. PLoS Genet. 2017 Jan 30;13(1):e1006592. Mutagen: Outcrossed: x3 Made by: Erika Fröhli Received: 01/23/20 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH346 Species: Caenorhabditis elegans Genotype: dep-1(zh34) unc-4(e120) II; lip-1(zh15) IV. Description: Pvl and weak Muv. Transformation of secondary to primary vulval cell fates. Mutagen: Outcrossed: x Made by: Thomas Berset Received: 12/27/05 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AH5059 Species: Caenorhabditis elegans Genotype: let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. Description: CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted). Mutagen: Outcrossed: x4 Made by: Silvan Spiri Received: 02/28/20 Technische Universitat Dresden ----------------------------------------------------------------------------- Strain: AH75 Species: Caenorhabditis elegans Genotype: apr-1(zh10) unc-29(e1072) I; zhEx11. Description: zhEx11[apr-1(+) + sur-5::GFP]. Unc. Segregates dead eggs that have lost the rescuing array. Mutagen: EMS Outcrossed: x6 Made by: Alex Hajnal Received: 07/24/00 University of Zurich, Zurich, Switzerland ----------------------------------------------------------------------------- Strain: AL132 Species: C. elegans Genotype: icIs132. Description: icIs132 [unc-40::GFP]. Superficially wild-type. unc-40 translational reporter. Reference: Chan SS, et al. Cell. 1996 Oct 18;87(2):187-95. Mutagen: none Outcrossed: x- Made by: unknown Received: 09/04/18 Instituto de Biomedicina de Valencia (IBV-CSIC), Valencia, Spain ----------------------------------------------------------------------------- Strain: ALF3 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; daf-12(rh61rh411) X. Description: Daf-d. Unc. Mutagen: Outcrossed: x0 Made by: Yue Zhang Received: 05/01/12 University of Nebraska Medical Center ----------------------------------------------------------------------------- Strain: ALF4 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; daf-12(rh61rh411) X; bafIs4. Description: bafIs4 [daf-12 (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179. Mutagen: Outcrossed: x0 Made by: Yue Zhang Received: 05/01/12 University of Nebraska Medical Center ----------------------------------------------------------------------------- Strain: ALF62 Species: Caenorhabditis elegans Genotype: bafIs62. Description: bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179. Mutagen: Bombardment Outcrossed: x4 Made by: Daniel Hochbaum Received: 05/01/12 University of Nebraska Medical Center ----------------------------------------------------------------------------- Strain: ALF63 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; bafIs63. Description: bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179. Mutagen: Outcrossed: x1 Made by: Daniel Hochbaum Received: 05/01/12 University of Nebraska Medical Center ----------------------------------------------------------------------------- Strain: ALF82 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; daf-12(rh61rh411) X; bafIs62. Description: bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Array was crossed into strain ALF3 to create ALF82. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179. Mutagen: Outcrossed: x0 Made by: Daniel Hochbaum Received: 05/01/12 University of Nebraska Medical Center ----------------------------------------------------------------------------- Strain: ALF9 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; daf-12(rh61rh411) X; bafIs9. Description: bafIs9 [daf-12::TAP (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. TAP tag inserted into daf-12 fosmid. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179. Mutagen: Outcrossed: x0 Made by: Yue Zhang Received: 05/01/12 University of Nebraska Medical Center ----------------------------------------------------------------------------- Strain: AM1 Species: Caenorhabditis elegans Genotype: osr-1(rm1) I. Description: Osmotic stress resistant. Received new stock May 7, 2008. Mutagen: EMS Outcrossed: x4 Made by: Aharon Solomon Received: 10/14/04 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AM101 Species: Caenorhabditis elegans Genotype: rmIs110. Description: rmIs110 [F25B3.3p::Q40::YFP]. Pan-neuronal YFP expression. Reference: Gidalevitz T, et al., Science. 2006 Mar 10;311(5766):1471-4. Mutagen: gamma irradiation Outcrossed: x0 Made by: Heather Brignull Received: 01/06/11 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AM1246 Species: C. elegans Genotype: rmIs126 X. Description: rmIs126 [unc-54p::Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. Worms maintain a soluble phenotype for the duration of their lifespan. [NOTE: This strain is a replacement for AM134, which was removed from distribution due to reports that it did not carry the correct transgene.] Mutagen: gamma irradiation Outcrossed: x5 Made by: Susana Garcia and Alex Chavez Received: 08/29/24 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AM138 Species: Caenorhabditis elegans Genotype: rmIs130 II. Description: rmIs130 [unc-54p::Q24::YFP]. Diffuse distribution of Q24::YFP throughout the body-wall muscle cells. Mutagen: Gamma Rays Outcrossed: x5 Made by: S. Garcia Received: 04/05/05 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AM140 Species: Caenorhabditis elegans Genotype: rmIs132 I. Description: rmIs132 [unc-54p::Q35::YFP]. AM140 animals show a Q35::YFP progressive transition from soluble to aggregated as they age. Mutagen: Gamma Rays Outcrossed: x5 Made by: S. Garcia/A Chavez Received: 04/05/05 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AM141 Species: Caenorhabditis elegans Genotype: rmIs133. Description: rmIs133 [unc-54p::Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype. Mutagen: Gamma Rays Outcrossed: x5 Made by: S. Garcia/A Chavez Received: 04/05/05 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AM263 Species: Caenorhabditis elegans Genotype: rmIs175. Description: rmIs175 [unc-54p::Hsa-sod-1 (WT)::YFP]. Array encodes wild-type human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399. Mutagen: gamma irradiation Outcrossed: x5 Made by: Tom Krupinski Received: 01/06/11 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AM44 Species: Caenorhabditis elegans Genotype: rmIs190. Description: rmIs190 [F25B3.3p::Q67::CFP]. Pan-neuronal CFP expression. Mutagen: gamma irradiation Outcrossed: x5 Made by: S Tang & H Brignull Received: 01/06/11 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AM49 Species: Caenorhabditis elegans Genotype: rmIs172. Description: rmIs172 [F25B3.3p::Q19::CFP]. Pan-neuronal CFP expression. Reference: Gidalevitz T, et al., Science. 2006 Mar 10;311(5766):1471-4. Mutagen: gamma irradiation Outcrossed: x5 Made by: S Tang & H Brignull Received: 01/06/11 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AM725 Species: Caenorhabditis elegans Genotype: rmIs290. Description: rmIs290 [unc-54p::Hsa-sod-1 (127X)::YFP]. Array encodes mutated form of human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399. Mutagen: gamma irradiation Outcrossed: x5 Made by: Tom Krupinski Received: 01/06/11 Northwestern University, Evanston, IL ----------------------------------------------------------------------------- Strain: AMH1 Species: C. elegans Genotype: unc-33(e204) IV; sosIs5. Description: sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH11 Species: C. elegans Genotype: wpIs36 I; sosIs5. Description: wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH13 Species: C. elegans Genotype: wpIs36 I; unc-33(e204) IV; sosIs5. Description: wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH151 Species: C. elegans Genotype: juIs76 II; daf-7(e1372) III. Description: juIs76 [unc-25p::GFP + lin-15(+)] II. Maintain at 15C. Temperature sensitive dauer constitutive. 100% dauers at 25C. Leaky at 20C. Crowds. Growth slow. GFP expression in GABAergic motor neurons. Mutagen: NA Outcrossed: x0 Made by: Andrea Holgado Received: 10/20/21 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH23 Species: C. elegans Genotype: wpIs36 I; unc-33(e1193) IV; sosIs5. Description: wpIs36 [unc-47p::mCherry] I. sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc; almost paralyzed. Growth slow. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH25 Species: C. elegans Genotype: dhc-1(or352) I; sosIs5. Description: sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Maintain at 15 degrees. Temperature-sensitive embryonic lethal. 100% dead embryos at 25 degrees. Small, posteriorly displaced first mitotic spindle with defective chomosome segregation and cytokinesis. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH26 Species: C. elegans Genotype: unc-104(e1265) II; sosIs5. Description: sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc. Slow moving. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH3 Species: C. elegans Genotype: unc-33(mn407) IV; sosIs5. Description: sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH30 Species: C. elegans Genotype: juIs76 II; daf-2(e1370) III. Description: juIs76 [unc-25p::GFP + lin-15(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH31 Species: C. elegans Genotype: juIs76 II; unc-33(e1193) IV. Description: juIs76 [unc-25p::GFP + lin-15(+)] II. Unc; almost paralyzed. Growth slow. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH32 Species: C. elegans Genotype: juIs76 II; unc-33(mn407) IV. Description: juIs76 [unc-25p::GFP + lin-15(+)] II. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH34 Species: C. elegans Genotype: juIs76 II; unc-33(e204) IV. Description: juIs76 [unc-25p::GFP + lin-15(+)] II. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH36 Species: C. elegans Genotype: juIs76 II; daf-2(e1370) III; unc-33(mn407) IV. Description: juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Maintain at 15C. Synthetic Lethality at 25C. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH38 Species: C. elegans Genotype: juIs76 II; daf-2(e1370) III; unc-33(e204) IV. Description: juIs76 [unc-25p::GFP + lin-15(+)] II. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH43 Species: C. elegans Genotype: unc-33(e204) IV; adIs2122. Description: adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Unc. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH46 Species: C. elegans Genotype: juIs76 II; daf-2(e1370) III; unc-33(e1193) IV. Description: Maintain at 15C. Synthetic Lethality at 25C. Unc; almost paralyzed. Growth slow. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH5 Species: C. elegans Genotype: unc-119(ed3) III; sosIs5. Description: sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Mutagen: Gamma Rays Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH50 Species: C. elegans Genotype: juIs76; bec-1(ok691) IV/nT1 [qIs51] (IV;V). Description: juIs76 [unc-25p::GFP + lin-15(+)] II.  Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-pharyngeal GFP bec-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 10/08/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH55 Species: C. elegans Genotype: daf-2(e1370) III; otIs117 IV. Description: otIs117 [unc-33p::GFP + unc-4(+)] IV. Maintain at 15C. Temperature-sensitive dauer constitutive. Pan-neuronal GFP. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH57 Species: C. elegans Genotype: unc-33(mn407); olaEx3013. Description: olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144 Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH59 Species: C. elegans Genotype: unc-33(e204); olaEx3013. Description: olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Paralyzed Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144 Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH61 Species: C. elegans Genotype: unc-13(e51) I; ddi-1(ok1468) IV. Description: ddi-1 also known as vsm-1. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH67 Species: C. elegans Genotype: unc-33(e204) IV; daf-2(e1370) III. Description: Maintain at 15C. Synthetic Lethality at 25C. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH69 Species: C. elegans Genotype: unc-33(mn407) IV; daf-2(e1370) III. Description: Maintain at 15C. Synthetic Lethality at 25C. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH7 Species: C. elegans Genotype: unc-51(e369) V; sosIs5. Description: sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Paralyzed Unc. Slow growth. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 10/08/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH71 Species: C. elegans Genotype: unc-33(e1193) IV; daf-2(e1370) III. Description: Maintain at 15C. Synthetic Lethality at 25C. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 06/06/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH73 Species: C. elegans Genotype: ddi-1(ok1468) IV; sosIs6. Description: sosIs6 [C01G5.6p::C01G5.6::GFP]. ddi-1 also known as vsm-1. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH82 Species: C. elegans Genotype: ccIs4251 I; ddi-1(ok1468) IV. Description: ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. ddi-1 also known as vsm-1. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH91 Species: C. elegans Genotype: unc-104(e1265) II; olaEx3013. Description: olaEx3013 [ttx-3p::mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Slow moving. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144 Mutagen: Outcrossed: x0 Made by: Andrea Holgado Received: 12/17/20 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMH96 Species: C. elegans Genotype: sosIs3. Description: sosIs3 [unc-119p::ddi-1::GFP]. ddi-1 also known as vsm-1. Mutagen: N/A Outcrossed: x0 Made by: Andrea Holgado Received: 07/10/19 St Edward's University, Austin, TX ----------------------------------------------------------------------------- Strain: AMJ345 Species: Caenorhabditis elegans Genotype: jamSi2 II; rde-1(ne219) V. Description: jamSi2 [mex-5p::rde-1(+)] II. mex-5p::rde-1(+) inserted into ttTi5605 on LG II. Tissue-specific RNAi rescue allows silencing in germline and intestine. Reference: Marre JA, et al. Proc Natl Acad Sci USA. 2016. Mutagen: MosSCI Outcrossed: x0 Made by: Julia Marre Received: 09/30/16 University of Maryland, College Park, MD ----------------------------------------------------------------------------- Strain: AML1 Species: Caenorhabditis elegans Genotype: zfIs18; zfIs42. Description: zfIs18 [mec-4p::ChR2::YFP]. zfIs42 [rig-3p::GCaMP3::SL2::mCherry]. Pick mCherry+ animals to maintain strong expression from zfIs42. Worm expresses light-sensitive Channelrhodopsin (ChR2) and yellow fluorescent protein (YFP) in mechanosensory neurons, ALMR/L, AVM, PLML/R, and PVM. When fed all-trans retinal, blue light stimulation (473 nm at 2 mW * mm^-2) of head induces reversals. GCaMP3 and and mCherry expression in command interneurons AVA, and nearby pharyngeal neurons I1, I4, M4, NSM. Worms were made by crossing the integrated strains QW309 and QW625. Reference: Shipley FB, et al. Front Neural Circuits. 2014 Mar 24;8:28. Mutagen: Outcrossed: x0 Made by: Frederick Shipley Received: 05/28/14 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML10 Species: Caenorhabditis elegans Genotype: otIs355; otIs45 V. Description: otIs355 [rab-3::NLS::tagRFP]. otIs45 [unc-119::GFP] V. Pan-neural expression with no injection marker. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81. Mutagen: Outcrossed: x0 Made by: George Plummer Received: 01/30/15 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML105 Species: C. elegans Genotype: wtfIs32. Description: wtfIs32 [str-2p::ChR2(H134R)::GFP +, myo-3p:mCherry]. Expression of an activating opsin molecule ChR2 (H134R) in AWC-ON neuron and mCherry in body wall muscles. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890. Mutagen: N/A Outcrossed: x6 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML14 Species: Caenorhabditis elegans Genotype: wtfEx4. Description: wtfEx4 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Pick RFP+ to maintain array. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81. Mutagen: Outcrossed: x Made by: G Plummer & S Setu Received: 11/30/15 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML17 Species: Caenorhabditis elegans Genotype: wtfIs2. Description: wtfIs2 [rig-3p::Chrimson::SL2::mCherry]. Transgenic animals express light-gated ion channel Chrimson and fluorescent protein mCherry in AVA neurons as well as nearby nearby pharyngeal neurons I1, I4, M4, NSM. Worms reverse more upon exposure to red light via optogenetic activation of AVA neurons. Reference: Kumar S, et al. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. PMID: 37733772. Mutagen: none Outcrossed: x0 Made by: Mochi Liu Received: 09/29/23 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML175 Species: Caenorhabditis elegans Genotype: lite-1(ce314) X; wtfIs3. Description: wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. Worms expressing the calcium insensitive fluorescent proteins GFP and tagRFP in the nuclei of all neurons in a lite-1(ce314) background. Control strain for AML70. Reference: https://www.biorxiv.org/content/biorxiv/early/2018/10/17/445643.full.pdf Mutagen: Outcrossed: x0 Made by: Anuj Sharma Received: 10/22/18 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML177 Species: C. elegans Genotype: wtfIs145. Description: wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3'UTR + pha-1(+)]. Pan-neuronal expression of nuclear-localized GCaMP6s. Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: N/A Outcrossed: x8 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML18 Species: Caenorhabditis elegans Genotype: wtfIs3. Description: wtfIs3 [rab-3p::NLS::GFP + rab-3p::NLS::tagRFP]. RFP and GFP expression in the nuclei of all neurons. AML18 acts as a control for the calcium imaging strain AML14. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81. Mutagen: Outcrossed: x2 Made by: George Plummer Received: 11/30/15 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML310 Species: Caenorhabditis elegans Genotype: wtfIs5; wtfEx258. Description: wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. wtfEx258 [rig-3p::tagBFP::unc-54 3'UTR]. Pick BFP+ animals to maintain transgene. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons for whole brain imaging. BFP expression from rig-3 promoter allows identification of AVAL/R neurons. Reference: Hallinen KM, et al. eLife. 2021 Jul 29;10:e66135. doi: 10.7554/eLife.66135. Mutagen: Outcrossed: x0 Made by: Anuj Sharma Received: 01/21/21 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML318 Species: C. elegans Genotype: otIs669 V. Description: Derived by out-crossing parental strain OH15262 an additional six times to N2. Out-crossed strain AML318 seems healthier than parental strain when maintaining long-term under normal conditions (AML observed an increase in male and sterile progeny in parental strain in successive generations.) otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642. Mutagen: N/A Outcrossed: x14 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML32 Species: Caenorhabditis elegans Genotype: wtfIs5. Description: wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. Derived from AML14 by integration of wtfEx4. Reference: Nguyen JP, et al. PLoS Comput Biol. 2017 May 18;13(5):e1005517. Mutagen: UV irradiation Outcrossed: x2 Made by: George Plummer Received: 10/20/16 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML320 Species: Caenorhabditis elegans Genotype: otIs669 V; wtfIs145. Description: wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Derived by out-crossing parental strain OH15262 an additional six times before incorporating wtfIs145. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623. Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: none Outcrossed: x6 Made by: Anuj Kumar Sharma Received: 08/24/22 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML344 Species: C. elegans Genotype: juSi164 unc-119(ed3) III; wtfIs263. Description: juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs263 [rab-3p::AI::ChR2(H134R)::unc-54 3'UTR + rab-3p::AI::Voltron::unc-54 3'UTR + rab-3p::his-24::tagBFP::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of ChR2 (H134R) along with Voltron volatage indicator and nuclear-localized tagBFP. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML376 Species: C. elegans Genotype: juSi164 unc-119(ed3) III; wtfEx296. Description: juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx296 [rab-3p::AI::gur-3G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Pick RFP+ to maintain. Keep plates covered to avoid unnecessary exposure to light. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML405 Species: C. elegans Genotype: juSi164 unc-119(ed3) III; wtfEx315. Description: juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfEx315 [5xQUAS::(delta)pes-10P::AI::gur-3G::unc-54 3'UTR + 5xQUAS::(delta)pes-10P::AI::prdx-2G::unc-54 3'UTR + rab-3p::AI::QF+hGR::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Worms expressing a purple light-sensitive optogenetic protein system: pan-neuronal expression of GUR-3 and PRDX-2. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML438 Species: C. elegans Genotype: juSi164 unc-119(ed3) III; wtfIs335. Description: juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs335 [5xQUAS+(delta)pes-10p::AI::eTsChR::unc-54 3'UTR + rab-3p::AI::QF+hGR::SL2::tagBFP::unc-54 3'UTR + rab-3p::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal eTsChR on activation using dex treatment via QF+hGR. Worms also express calcium sensing fluorescence protein- GCaMP6s in nuclei of each neurons. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML456 Species: Caenorhabditis elegans Genotype: wtfIs348. Description: wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS-3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. Reference: Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: none Outcrossed: x8 Made by: Anuj Kumar Sharma Received: 08/24/22 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML462 Species: Caenorhabditis elegans Genotype: otIs669 V; wtfIs145; wtfIs348. Description: wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. References: Yu X, et al. Elife. 2021 Jul 14;10:e66410. doi: 10.7554/eLife.66410. PMID: 34259623. Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: none Outcrossed: x0 Made by: Anuj Kumar Sharma Received: 08/24/22 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML470 Species: Caenorhabditis elegans Genotype: juSi164 unc-119(ed3) III; wtfIs458. Description: juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs458 [mec-4::Chrimson4.2::SL2::mCherry::unc-54 3' UTR + unc-122::GFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Transgenic animals express light-gated ion channel Chrimson and a fluorescent protein mCherry in mechanosensory neurons alongside GFP in coelomocytes. Reference: Liu M, et al. PLoS Biol. 2022 Jan 28;20(1):e3001524. doi: 10.1371/journal.pbio.3001524. PMID: 35089912. Mutagen: none Outcrossed: x0 Made by: Anuj Sharma Received: 08/11/21 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML496 Species: C.elegans Genotype: wtfIs465. Description: wtfIs465 [lim-4p::gtACR2::SL2::eGFP::unc-54 3' UTR + unc-122::RFP]. Transgenic animals express light-gated ion channel gtACR2 and a fluorescent protein eGFP in turning associated neurons RIV, SMB and SAA, alongside RFP in coelomocytes. Reference: Kumar S, et al. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. PMID: 37733772. Mutagen: Outcrossed: x6 Made by: Anuj Sharma & Sandeep Kumar Received: 12/20/22 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML499 Species: C.elegans Genotype: wtfIs46; wtfIs465. Description: wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfIs465 [lim-4p::gtACR2::SL2::eGFP::unc-54 3' UTR + unc-122::RFP]. Transgenic animals express light-gated ion channel Chrimson and mCherry in mechanosensory neurons, and light-gated ion channel gtACR2 and eGFP in turning associated neurons RIV, SMB and SAA. RFP expression in coelomocytes. Reference: Kumar S, et al. PLoS Biol. 2023 Sep 21;21(9):e3002280. doi: 10.1371/journal.pbio.3002280. PMID: 37733772. Mutagen: Outcrossed: x6 Made by: Anuj Sharma and Sandeep Kumar Received: 12/20/22 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML5 Species: Caenorhabditis elegans Genotype: otIs355 IV; lin-15B&lin-15A(n765) X; kyIs51. Description: otIs355 [rab-3p(prom1)::2xNLS::TagRFP] IV. kyIs51 [odr-2b::GFP + lin-15(+)]. Pan-neuronal nuclear RFP expression. Cytoplasmic GFP expressed in the odr-2b neurons including AIZ, AIB, SIAV, AVG, RIV, ASG and IL2 neurons. Derived from parental strains QW1155 and CX3300. Reference: Nguyen JP, et al. Proc Natl Acad Sci U S A. 2016 Feb 23;113(8):E1074-81. Mutagen: Outcrossed: x Made by: George Plummer Received: 11/30/15 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML508 Species: Caenorhabditis elegans Genotype: unc-31(wtf502) IV; otIs669 V; wtfIs145; wtfIs348. Description: wtfIs145 [rab-3p::his-24::GCaMP6s::unc-54 3' UTR + pBX]. wtfIs348 [pAS3-5xQUAS::(delta)pes-10p::AI::gur-3G::unc-54 3' UTR + pAS3-5xQUAS::(delta)pes-10p::AI::prdx-2G::unc-54 3' UTR + pAS3-rab-3p::AI::QF+GR::unc-54 3' UTR + unc-122::GFP]. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) in each neuron, and GFP in coelomocytes. GCaMP6s transgene allows for imaging whole-brain calcium activity with neuronal identification using NeuroPAL system. unc-31(wtf502) is a CRISPR-engineered deletion allele. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Derived by out-crossing parental strain OH15262 an additional six times before incorporating other transgenes. Reference: Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Anuj Kumar Sharma Received: 08/24/22 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML535 Species: C. elegans Genotype: wtfEx478. Description: wtfEx478 [rab-3p::AI::lite-1G::SL2::tagBFP::unc-54 3'UTR + unc-122p::GFP]. Pick GFP+ animals to maintain. Worms express purple/violet light-sensitive optogenetic protein LITE-1 pan-neuronallly and nuclear-localized blue fluorescent protein tagBFP via SL2 trans-slpicing regulatory sequence. Worms also express GFP in coelomocytes. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML540 Species: C. elegans Genotype: juSi164 unc-119(ed3) III; wtfIs483. Description: juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs483 [rab-3p::AI::lite-1G::unc-54 3'UTR + rab-3p::AI::prdx-2G::SL2::his-24::tagRFP::unc-54 3'UTR + rab-3p::his-24::GCaMP6s::unc-54 3'UTR]. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of a purple/violet light-sensitive optogenetic protein system LITE-1 and PRDX-2 with nuclear-localized tagRFP and GCaMP6s. Reporter construct contains an artificial intron (AI). Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML546 Species: Caenorhabditis elegans Genotype: wtfEx496. Description: wtfEx496 [pAS3-rig-3p::AI::gur-3G::SL2::tagRFP::unc-54 3'UTR + pAS3-rig-3p::AI::prdx-2G::SL2::tagBFP::unc-54 3'UTR]. Pick animals either BFP or RFP expression in head neurons to maintain. Keep plates covered to avoid unnecessary exposure to light. This strain expresses a purple light-sensitive optogenetic protein system (i.e., GUR-3 and PRDX-2) alongside fluorescent proteins tagBFP and tagRFP in command interneurons AVA, and nearby pharyngeal neurons I1, I4, M4, NSM using rig-3 promoter. Worms exhibit higher reversal rate on exposing to blue light (peak value ~470) compared to controls. Reference: Randi F, et al. Nature 2023 Nov;623(7986):406-414. doi: 10.1038/s41586-023-06683-4. PMID: 37914938. Mutagen: No Outcrossed: x0 Made by: Anuj Sharma Received: 05/30/23 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML551 Species: Caenorhabditis elegans Genotype: gur-3(ok2245) X; wtfIs5. Description: wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a gur-3(ok2245) mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919. Mutagen: Outcrossed: x0 Made by: Anuj Sharma Received: 01/12/23 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML554 Species: Caenorhabditis elegans Genotype: lite-1(ce314) gur-3(ok2245) X; wtfIs5. Description: wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a lite-1(ce314) gur-3(ok2245) double mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919. Mutagen: Outcrossed: x0 Made by: Anuj Sharma Received: 01/12/23 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML580 Species: C. elegans Genotype: wtfIs491. Description: wtfIs491 [inx-1p::twk-18(gf)::mCherry + unc-122p::RFP]. AIB(-) activated potassium channel. Expression of twk-18 gain-of-function mutant in AIB neurons causes permanent inhibition. RFP expression in coelomocytes. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890. Mutagen: N/A Outcrossed: x6 Made by: Anuj Sharma & Kevin Chen Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML597 Species: C. elegans Genotype: lgc-47(sy1501) X; wtfIs46. Description: wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma and Sandeep Kumar Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML614 Species: C. elegans Genotype: lgc-47(sy1501) X; wtfIs46; wtfEx535. Description: wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx535 [tdc-1p::AI::lgc- 47::SL2::his-24::tagRFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in RIML/R neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML617 Species: C. elegans Genotype: lgc-47(sy1501) X; wtfIs46; wtfEx538. Description: wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx538 [npr-9p::AI::lgc-47::SL2::tagBFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML618 Species: C. elegans Genotype: lgc-47(sy1501) X; wtfIs46; wtfEx539. Description: wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx539 [rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AVA neuron. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML622 Species: C. elegans Genotype: lgc-47(sy1501) X; wtfIs46; wtfEx543. Description: wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. wtfEx543 [tdc-1p::AI::lgc-47::SL2::his-24::tagRFP + npr-9p::AI::lgc-47::SL2::tagBFP + rig-3p::AI::lgc-47::SL2::GFP + unc-122p::GFP]. Pick animals with GFP+ coelomocytes to maintain. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Rescuing LGC-47 expression in AIB, AVA, and RIM neurons. Reporter construct contains an artificial intron (AI). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML627 Species: C. elegans Genotype: acc-1 (tm3268) IV; wtfIs46. Description: wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Expression of activating opsin molecule Chrimson in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. bioRxiv 2024.03.21.586204; doi: https://doi.org/10.1101/2024.03.21.586204. PMID: 38585821. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML659 Species: Caenorhabditis elegans Genotype: acc-1(tm3268) IV; lgc-47(sy1501) X; wtfIs46. Description: wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. mec-4 promoter drives expression of activating opsin molecule Chrimson and fluorescent protein mCherry in six gentle-touch mechanosensory neurons (ALML/R, AVM, PLML/R, PVM). Reference: Kumar S, et al. An inhibitory acetylcholine receptor gates context dependent mechanosensory processing in C. elegans. (2024) iScience. https://www.sciencedirect.com/science/article/pii/S2589004224020017 PMID: 38585821. Mutagen: none Outcrossed: x0 Made by: Anuj Sharma Received: 09/27/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML67 Species: Caenorhabditis elegans Genotype: wtfIs46. Description: wtfIs46 [mec-4p::Chrimson::SL2::mCherry::unc-54 3'UTR]. Transgenic animals express light-gated ion channel Chrimson and mCherry in mechanosensory neurons. Reference: Liu M, et al. eLife 2018;7:e36419 DOI: 10.7554/eLife.36419. Mutagen: Outcrossed: x6 Made by: Anuj Kumar Sharma Received: 03/26/18 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML70 Species: Caenorhabditis elegans Genotype: lite-1(ce314) X; wtfIs5. Description: wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a lite-1(ce314) mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919. Mutagen: Outcrossed: x0 Made by: Anuj Sharma Received: 10/22/18 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AML73 Species: C. elegans Genotype: pha-1(e2123)III; wtfEx48. Description: wtfEx48 [rab-3p::Chrimson::unc-54 3'UTR + pha-1(+)]. Maintain at 20-25C to select for animals carrying the array. Keep plates covered to avoid unnecessary exposure to light. Pan-neuronal expression of Chrimson. Reference: Sharma AK, et al. Genetics 2024 May 11:iyae077. doi: 10.1093/genetics/iyae077 PMID: 38733622. Mutagen: N/A Outcrossed: x0 Made by: Anuj Sharma Received: 07/12/24 Princeton University, Princeton NJ ----------------------------------------------------------------------------- Strain: AMP100 Species: C. elegans Genotype: ieSi57 II; rpb-2(cer135[rpb-2::GFP(delta)piRNA::AID::3xFLAG]) III. Description: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. cer135 is a rpb-2::GFP(delta)piRNA::AID::3xFLAG tag inserted into the endogenous rpb-2 locus. This strain allows auxin-dependent disruption of RNA polymerase II with dose-dependent lifespan shortening. Reference: Oswal N, et al. PLoS Comput Biol. 2022 Sep 30;18(9):e1010415. PMID: 36178967. Mutagen: Crispr/Cas9 Outcrossed: x1 Made by: ‪J. Vicencio, N. Oswal, N.Stroustrup & J. Ceron Received: 12/21/22 Centre de Regulacio Genomica, Barcelona, Spain ----------------------------------------------------------------------------- Strain: AN170 Species: Caenorhabditis elegans Genotype: aff-1(ty4) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Description: Heterozygotes are WT and segregate WT (heterozygotes), Unc-4 worms which are strong Egl (ty4 homozygotes), and paralyzed Dpy Uncs (mnC1 homozygotes). Mutagen: EMS Outcrossed: x5 Made by: J Choi/A Newman Received: 02/19/08 Wright State University ----------------------------------------------------------------------------- Strain: AN87 Species: Caenorhabditis elegans Genotype: sel-12(ty11) X. Description: Egl. Premature stop codon. Mutagen: EMS Outcrossed: x6 Made by: Nese Cinar Received: 12/04/01 Baylor College of Medicine, Houston, TX ----------------------------------------------------------------------------- Strain: ANA65 Species: C. elegans Genotype: adeIs1 II; unc-119(ed3) III. Description: adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. The transgene has been inserted on chromosome II, using the MosSCI technique. This strains expresses the SPD-1 protein fused to GFP in the germline (both males and females) and in embryos. SPD-1 is nucleolar in interphase and labels the central spindle in mitosis and meiosis, later accumulating at the midbody. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9. doi: 10.1091/mbc.E14-12-1577. Mutagen: MosSCI Outcrossed: x2 Made by: Melissa ZOUAK Received: 11/12/19 Ecole Normale Superieure de Lyon, Lyon, France ----------------------------------------------------------------------------- Strain: ANA72 Species: C. elegans Genotype: adeIs1 II; unc-119(ed3) III; ltIs37 IV. Description: adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Superficially wild-type. SPD-1::GFP and mCherry-tagged histones allow visualisation of chromatin with central spindle/midbody during cell divisions. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9. Mutagen: MosSCI Outcrossed: x2 Made by: Melissa ZOUAK Received: 11/12/19 Ecole Normale Superieure de Lyon, Lyon, France ----------------------------------------------------------------------------- Strain: ANR149 Species: Caenorhabditis elegans Genotype: rrf-1(pk1417) I; pkIs2386. Description: pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. YFP expression in the muscles. Derived by crossing parental strains NL5901 and MAH23 to produce a Parkinson's model with germline-only RNAi. unc-119 might still be present in the background, but likely lost during crossing. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark. Mutagen: none Outcrossed: x0 Made by: Santina Snow Received: 04/15/24 Mt Desert Island Bio Lab, Salisbury Cove, ME ----------------------------------------------------------------------------- Strain: ANR153 Species: Caenorhabditis elegans Genotype: rde-1(ne300) V.; neIs9 X; pkIs2386. Description: pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. neIs9 [myo-3::HA::rde-1 + rol-6(su1006)] X. Rollers. YFP expression in the muscles. Derived by crossing parental strains NL5901 and WM118 to produce a Parkinson's model with muscle-only RNAi. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark. Mutagen: none Outcrossed: x0 Made by: Santina Snow Received: 04/15/24 Mt Desert Island Bio Lab, Salisbury Cove, ME ----------------------------------------------------------------------------- Strain: ANR165 Species: C. elegans Genotype: eif-2alpha(rog3) I. Description: eif-2alpha(rog3) is a (S49A) substitution allele (I:2073439..2073448; WS220) removing P site and PAM site. eif-2alpha (Y37E3.10) encodes the alpha subunit of eukaryotic translation initiation factor 2 (eIF2). Reference: Rollins J, et al. Loss of eif-2alpha phosphorylation on S49 (mammalian S51) associated with the integrated stress response hastens development in C. elegans. MicroPubl Biol. 2017;2017:10.17912/W2BM1S. doi: 10.17912/W2BM1S. Erratum in: MicroPubl Biol. 2020 Feb 27;2020: PMID: 32292896. Mutagen: Outcrossed: x0 Made by: Jarod Rollins Received: 10/23/23 Mt Desert Island Bio Lab, Salisbury Cove, ME ----------------------------------------------------------------------------- Strain: ANR168 Species: Caenorhabditis elegans Genotype: lin-15B(n744) X; pkIs2386; uIs57. Description: pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. uIs57 [unc-119p::YFP + unc-119p::sid-1 + mec-6p::mec-6]. YFP expression in the muscles. Parkinson's model with hypersensitive neuronal RNAi. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark. Mutagen: none Outcrossed: x0 Made by: Santina Snow Received: 04/15/24 Mt Desert Island Bio Lab, Salisbury Cove, ME ----------------------------------------------------------------------------- Strain: AP36 Species: Caenorhabditis elegans Genotype: mep-1(ok421)/nT1 [qIs51] (IV;V). Description: qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok421 homozygotes, wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Received new stock 12/02. Mutagen: UV/TMP Outcrossed: x5 Made by: A Puoti Received: 08/14/02 University of Fribourg, Switzerland ----------------------------------------------------------------------------- Strain: APL31 Species: C. elegans Genotype: lin-12(ljf31[lin-12::mNeonGreen[C1]::3xFLAG]) III. Description: mNG and 3xFLAG tags fused to the C-terminal end of the intracellular domain of the endogenous lin-12 locus using a 9 amino acid flexible linker. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. Mutagen: Outcrossed: x0 Made by: Ariel Pani Received: 10/23/23 University of Virginia ----------------------------------------------------------------------------- Strain: AQ3236 Species: C. elegans Genotype: ljSi2 II; unc-119(ed3) III. Description: ljSi2 [mec-7::GCaMP6m::SL2::TagRFP + unc-119(+)] II. GCaMP6m (13.693) and RFP expressed in touch receptor neurons (ALML/R, AVM, PVM, PLML/R). Dual expression of GCamp6m and RFP allows for ratio-metric corrections of motion artifacts. Reference: Cho Y, et al. Lab Chip. 2017 Jul 25;17(15):2609-2618. Mutagen: Outcrossed: x0 Made by: Dr. William Schafer Received: 11/10/17 Georgia Institute of Technology ----------------------------------------------------------------------------- Strain: AQ351 Species: C. elegans Genotype: bus-8A(lj22) X. Description: Skiddy, bleach-sensitive, drug-sensitive, Bus, resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: Partridge et al. (2008) PMID: 18395708. Mutagen: EMS Outcrossed: x2? Made by: A W Tearle Received: 10/10/17 Oxford University, Oxford, England ----------------------------------------------------------------------------- Strain: AQ866 Species: Caenorhabditis elegans Genotype: ser-4(ok512) III. Description: Y22D7AR.13. Hyperactive 5HT induced egglaying. Homozygous. Outer Left Sequence: AATTATCGGATTTAGGGCCG. Outer Right Sequence: ATGGAACGGAGCATTATTCG. Inner Left Sequence: CAACACGCAACGAATGTACC. Inner Right Sequence: TGTGAAGTTTGGGAGGCTTT. Inner primer WT PCR product: 3126. Outcrossed 5 times by Stanley Shyn. URL: http://www.celeganskoconsortium.omrf.org. Mutagen: UV/TMP Outcrossed: x5 Made by: Stanley Shyn Received: 02/24/03 MRC - LMB, Cambridge, UK ----------------------------------------------------------------------------- Strain: AR1 Species: Caenorhabditis elegans Genotype: hcp-6(mr17) I. Description: 15C: no phenotype. 26C: shifted as L4 or later results in 100% embryonic lethality; shifted before L4 results in Unc and Sterile animals. Intermediate phenotypes between 20-23C. Mutagen: EMS Outcrossed: x5 Made by: Roth/Morrison/Stear Received: 11/04/02 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR10 Species: Caenorhabditis elegans Genotype: cysl-1(mr25) X. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x1 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR11 Species: Caenorhabditis elegans Genotype: cysl-1(mr26) X. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x1 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR12 Species: Caenorhabditis elegans Genotype: suls-1(mr27) V. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR13 Species: Caenorhabditis elegans Genotype: sqrd-1(mr28) IV. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR14 Species: Caenorhabditis elegans Genotype: cysl-1(mr29) X. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR15 Species: Caenorhabditis elegans Genotype: sqrd-1(mr30) IV. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR16 Species: Caenorhabditis elegans Genotype: suls-2(mr31) I. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR17 Species: Caenorhabditis elegans Genotype: sqrd-1(mr32) IV. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR18 Species: Caenorhabditis elegans Genotype: cysl-1(mr33) X. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR19 Species: Caenorhabditis elegans Genotype: cysl-1(mr34) X. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x1 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR2 Species: Caenorhabditis elegans Genotype: hcp-6(mr17) unc-73(e936) I. Description: Unc at all temperatures. For hcp-6: 15C: no phenotype. 26C: shifted as L4 or later results in 100% embryonic lethality; shifted before L4 results in Unc and Sterile animals. Intermediate phenotypes between 20-23C. Mutagen: Outcrossed: x Made by: Jeff Stear Received: 11/04/02 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR20 Species: Caenorhabditis elegans Genotype: suls-1(mr35) V. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR21 Species: Caenorhabditis elegans Genotype: suls-2(mr36) I. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x1 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR23 Species: Caenorhabditis elegans Genotype: suls-1(mr38) V. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR24 Species: Caenorhabditis elegans Genotype: cysl-1(mr39) X. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR25 Species: Caenorhabditis elegans Genotype: cysl-1(mr40) X. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR3 Species: Caenorhabditis elegans Genotype: suls-1(mr18) V. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR4 Species: Caenorhabditis elegans Genotype: cysl-1(mr19) X. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR5 Species: Caenorhabditis elegans Genotype: hif-1(mr20) V. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR6 Species: Caenorhabditis elegans Genotype: sqrd-1(mr21) IV. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR7 Species: Caenorhabditis elegans Genotype: hif-1(mr22) V. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR8 Species: Caenorhabditis elegans Genotype: cysl-1(mr23) X. Description: Sensitive to hydrogen sulfide and hydrogen cyanide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: AR9 Species: Caenorhabditis elegans Genotype: sqrd-1(mr24) IV. Description: Sensitive to hydrogen sulfide. Reference: Budde MW, Roth MB. Genetics. 2011 Oct;189(2):521-32. Mutagen: EMS Outcrossed: x0 Made by: Mark Budde Received: 09/10/11 Fred Hutchinson Cancer Research Center, Seattle, WA ----------------------------------------------------------------------------- Strain: ARK7 Species: C. elegans Genotype: spe-36(nwk1[spe-36::gfp]) IV; him-5(e1490) V. Description: GFP tag inserted into endogenous spe-36 (F40F11.4) locus. SPE-36::GFP expression in spermatids and spermatozoa. Reference: Krauchunas AR, et al. Curr Biol. 2023 Jul 24;33(14):3056-3064.e5. doi: 10.1016/j.cub.2023.06.051. PMID: 37453426. Mutagen: Outcrossed: x0 Made by: Amber Krauchunas Received: 02/01/24 University of Delaware ----------------------------------------------------------------------------- Strain: ARM101 Species: Caenorhabditis elegans Genotype: wamSi101 V; unc-119(ed3) III. Description: wamSi101 [eft-3p::mTFP::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mTFP from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10. Mutagen: Outcrossed: x0 Made by: Alex Mendenhall Received: 05/04/18 University of Washington ----------------------------------------------------------------------------- Strain: ARM103 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; wamSi103 V. Description: wamSi103 [eft-3p::mKO2::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mKO2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10. Mutagen: Outcrossed: x0 Made by: Alex Mendenhall Received: 05/04/18 University of Washington ----------------------------------------------------------------------------- Strain: ARM112 Species: Caenorhabditis elegans Genotype: wamSi112 II; unc-119(ed3) III Description: wamSi112 [eft-3p::mScarlet::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mScarlet from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10. Mutagen: Outcrossed: x0 Made by: Alex Mendenhall Received: 05/04/18 University of Washington ----------------------------------------------------------------------------- Strain: ARM118 Species: Caenorhabditis elegans Genotype: wamSi118 II; unc-119(ed3) III. Description: wamSi118 [eft-3p::mCerulean3::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mCerulean3 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10. Mutagen: Outcrossed: x0 Made by: Alex Mendenhall Received: 05/04/18 University of Washington ----------------------------------------------------------------------------- Strain: ARM123 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; wamSi123 V. Description: wamSi123 [eft-3p::mECitrine::unc-54 3'UTR + Cbr-unc-119 (+)] V. Expresses a single copy of mECitrine from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10. Mutagen: Outcrossed: x0 Made by: Alex Mendenhall Received: 05/04/18 University of Washington ----------------------------------------------------------------------------- Strain: ARM3 Species: Caenorhabditis elegans Genotype: wamSi3 II; unc-119(ed3) III. Description: wamSi3 [eft-3p::mNeptune::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mNeptune from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10. Mutagen: Outcrossed: x0 Made by: Alex Mendenhall Received: 05/04/18 University of Washington ----------------------------------------------------------------------------- Strain: ARM6 Species: Caenorhabditis elegans Genotype: wamSi6 II; unc-119(ed3) III. Description: wamSi6 [eft-3p::mTagBFP2::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagBFP2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10. Mutagen: Outcrossed: x0 Made by: Alex Mendenhall Received: 05/04/18 University of Washington ----------------------------------------------------------------------------- Strain: ARM7 Species: Caenorhabditis elegans Genotype: wamSi7 II; unc-119(ed3) III. Description: wamSi7 [eft-3p::mTagRFP-T::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagRFP-T from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10. Mutagen: Outcrossed: x0 Made by: Alex Mendenhall Received: 05/04/18 University of Washington ----------------------------------------------------------------------------- Strain: AS270 Species: Caenorhabditis elegans Genotype: gly-12(id47) X. Description: Phenotypically WT. F3.2 See also WBPaper00005927. Mutagen: UV/TMP Outcrossed: x5 Made by: Received: 03/12/03 Hospital for Sick Children, Toronto, Ontario, Canada ----------------------------------------------------------------------------- Strain: AS271 Species: Caenorhabditis elegans Genotype: gly-14(id48) III. Description: Phenotypically WT. M8ns. See also WBPaper00005927. Mutagen: UV/TMP Outcrossed: x5 Made by: Received: 03/12/03 Hospital for Sick Children, Toronto, Ontario, Canada ----------------------------------------------------------------------------- Strain: AS338 Species: Caenorhabditis elegans Genotype: dpy-6(e14) gly-13(ok712) X. Description: Mutagen: UV/TMP Outcrossed: x5 Made by: Harry Schachter Received: 01/24/04 Hospital for Sick Children, Toronto, Ontario, Canada ----------------------------------------------------------------------------- Strain: AT10 Species: Caenorhabditis elegans Genotype: srf-3(yj10) IV. Description: Superficially wild-type. Antibody staining required to observe phenotype. Contains at least one extraneous mutation in the background (Eur. Worm Mtg 2006, Venuz et al.). Mutagen: Outcrossed: x Made by: Received: 06/18/90 Worcester Polytechnic Institute ----------------------------------------------------------------------------- Strain: AT18 Species: C elegans Genotype: srf-6(yj13) II. Description: No visible phenotype. Whole genome sequenced strain. Reference: Grenache DG, et al. Proc Natl Acad Sci U S A. 1996 Oct 29;93(22):12388-93. Mutagen: EMS Outcrossed: x2 Made by: Karl J. Chin Received: 06/26/19 Worcester Polytechnic Institute ----------------------------------------------------------------------------- Strain: AT24 Species: C. elegans Genotype: srf-6(yj15) II. Description: No visible phenotype. Whole genome sequenced strain. Mutagen: EMS Outcrossed: x2 Made by: Karl J. Chin Received: 06/26/19 Worcester Polytechnic Institute ----------------------------------------------------------------------------- Strain: AT25 Species: C elegans Genotype: srf-6(yj41) II. Description: No visible phenotype. Whole genome sequenced strain. Mutagen: EMS Outcrossed: x2 Made by: Karl J. Chin Received: 06/27/19 Worcester Polytechnic Institute ----------------------------------------------------------------------------- Strain: AT28 Species: C. elegans Genotype: kyIs140 I; srf-6(yj13) unc-4(e120) II. Description: kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4). Mutagen: EMS Outcrossed: x0 Made by: Samuel M Politz Received: 06/26/19 Worcester Polytechnic Institute ----------------------------------------------------------------------------- Strain: AT30 Species: C. elegans Genotype: kyIs140 I; nsy-1(ok593) unc-4(e120) II. Description: kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons. Mutagen: Outcrossed: x0 Made by: Samuel M Politz Received: 06/26/19 Worcester Polytechnic Institute ----------------------------------------------------------------------------- Strain: AT6 Species: Caenorhabditis elegans Genotype: srf-2(yj262) I. Description: Superficially wild-type. Antibody staining required to observe phenotype. Mutagen: EMS Outcrossed: x Made by: Miguel Estevez Received: 06/18/90 Worcester Polytechnic Institute ----------------------------------------------------------------------------- Strain: ATD1 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; sqt-3(sc8) par-1(b274) V/nT1[unc-?(n754) let-?] (IV;V); zuIs45 V. Description: zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced heterozygotes are Unc and segregate Unc (heterozygotes), Rol Par (sqt-3 par-1 homozygotes; maternal effect lethal), and dead eggs (nT1 homozygotes). NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK288. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231. Mutagen: Outcrossed: x0 Made by: Lawrence E. Small Received: 12/18/17 Ohio State University, Columbus, OH ----------------------------------------------------------------------------- Strain: ATD2 Species: Caenorhabditis elegans Genotype: par-2(or373) unc-119(ed3) III; zuIs45 V. Description: zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Temperature-sensitive maternal-effect lethal. Maintain at 15C. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and EU822. Unknown if unc-119(ed3) is still present or homozygous in background. NOTE: this strain was originally described as heterozygous for lin-2(e1309), but lin-2 has been lost; this strain is now homozygous wild-type for lin-2. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231. Mutagen: Outcrossed: x0 Made by: Lawrence E. Small Received: 12/18/17 Ohio State University, Columbus, OH ----------------------------------------------------------------------------- Strain: ATD3 Species: Caenorhabditis elegans Genotype: lon-1(e185) par-3(e2074) unc-119(ed3) III; zuIs45 V; sDp3(III;f) Description: zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Pick wild-type to maintain. Worms carrying the sDp3 duplication are wild-type; animals that have lost the duplication are Lon Par (maternal effect lethal). Cross of JJ1473 and KK237. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231. Mutagen: Outcrossed: x0 Made by: Lawrence E. Small Received: 12/18/17 Ohio State University, Columbus, OH ----------------------------------------------------------------------------- Strain: ATD6 Species: Caenorhabditis elegans Genotype: par-6(zu222) unc-101(m1)/hIn1[unc-54(h1040)] I; unc-119(ed3) III; zuIs45 V. Description: zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced worms are wild-type and segregate wild-type (heterozygotes), Coil Par (par-6 unc-101 homozygotes; maternal effect lethal), and paralyzed Unc (hIn1 homozygotes). Par phenotype is slightly leaky, but survivors are agametic. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK818. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231. Mutagen: Outcrossed: x0 Made by: Lawrence E. Small Received: 12/18/17 Ohio State University, Columbus, OH ----------------------------------------------------------------------------- Strain: ATD7 Species: Caenorhabditis elegans Genotype: par-2(ok1723)/sC1[dpy-1(s2170)], unc-119(ed3?) III; zuIs45 V. Description: zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Heterozygous worms are wild type and segregate wild type, Par (maternal effect lethal), and Dpy (sC1 homozygotes). Heterozygous and Par adults are indistinguishable on the plate. Maintain by picking wild-type worms and checking for correct segregation of progeny. NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and VC1313. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231. Mutagen: Outcrossed: x0 Made by: Lawrence E. Small Received: 12/18/17 Ohio State University, Columbus, OH ----------------------------------------------------------------------------- Strain: ATU2301 Species: Caenorhabditis elegans Genotype: aceIs1; goeIs3. Description: goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc54 3'UTR + unc-119(+)]. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator cytosolic GCaMP3 and mitochondrial LAR-GECO in all body wall muscles. Mutagen: Outcrossed: x0 Made by: Atsushi Higashitani Received: 05/09/22 Graduate School of Life Sciences, Tohoku University ----------------------------------------------------------------------------- Strain: ATU3301 Species: Caenorhabditis elegans Genotype: ccIs4251 I; aceIs1. Description: ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator mitochondrial LAR-GECO in all body wall muscles. Mutagen: Outcrossed: x0 Made by: Atsushi Higashitani Received: 05/09/22 Graduate School of Life Sciences, Tohoku University ----------------------------------------------------------------------------- Strain: ATU4301 Species: Caenorhabditis elegans Genotype: aceIs1. Description: aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator mitochondrial LAR-GECO in all body wall muscles. Mutagen: Outcrossed: x0 Made by: Atsushi Higashitani Received: 05/09/22 Graduate School of Life Sciences, Tohoku University ----------------------------------------------------------------------------- Strain: AU1 Species: Caenorhabditis elegans Genotype: sek-1(ag1) X. Description: Enhanced susceptibility to pathogens (Esp). Egl-d. Nsy. Also called esp-2. Mutagen: EMS Outcrossed: x3 Made by: R. Feinbaum Received: 02/26/03 Massachusetts General Hospital, Boston, MA ----------------------------------------------------------------------------- Strain: AU133 Species: Caenorhabditis elegans Genotype: agIs17 IV. Description: agIs17 [myo-2p::mCherry + irg-1p::GFP] IV. GFP in pharynx and intestine that turns on upon infection with pathogenic Pseudomonas aeruginosa strain PA14. Reference: Dunbar TL, et al. Cell Host Microbe. 2012 Apr 19;11(4):375-86. Mutagen: Outcrossed: x4 Made by: Emily Troemel Received: 09/09/13 UCSD, La Jolla CA, USA ----------------------------------------------------------------------------- Strain: AU147 Species: Caenorhabditis elegans Genotype: daf-16(mgDf47) I; glp-1(e2141) III. Description: Temperature sensitive sterility. Maintain at 15C. Mutagen: Outcrossed: x Made by: Sachiko Miyata Received: 04/16/08 Massachusetts General Hospital, Boston, MA ----------------------------------------------------------------------------- Strain: AU166 Species: Caenorhabditis elegans Genotype: daf-16(mgDf47) I; fog-2(q71) V. Description: Temperature sensitive. Maintain by mating males & females at 15C. fog-2(q71) is male-female. Mutagen: Outcrossed: x Made by: Sachiko Miyata Received: 05/19/08 Massachusetts General Hospital, Boston, MA ----------------------------------------------------------------------------- Strain: AU3 Species: Caenorhabditis elegans Genotype: nsy-1(ag3) II. Description: Enhanced susceptibility to pathogens (Esp). Nsy. Egl-d. Also called esp-8. Mutagen: EMS Outcrossed: x3 Made by: G. Alloing Received: 02/26/03 Massachusetts General Hospital, Boston, MA ----------------------------------------------------------------------------- Strain: AU37 Species: Caenorhabditis elegans Genotype: glp-4(bn2) I; sek-1(km4) X. Description: Temperature sensitive sterility. Maintain at 15C. Enhanced sensitivity to pathogens. Mutagen: Outcrossed: x Made by: Terence Moy Received: 04/16/08 Massachusetts General Hospital, Boston, MA ----------------------------------------------------------------------------- Strain: AU78 Species: Caenorhabditis elegans Genotype: agIs219 III. Description: agIs219 [T24B8.5p::GFP::unc-54 3' UTR + ttx-3p::GFP::unc-54 3' UTR] III. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30. Mutagen: Outcrossed: x3 Made by: Dennis Kim Received: 07/31/13 Boston Children's Hospital, Harvard Medical School ----------------------------------------------------------------------------- Strain: AU98 Species: Caenorhabditis elegans Genotype: inx-14(ag17) I. Description: Enhanced pathogen resistance. Mutagen: EMS Outcrossed: x5 Made by: Sachiko Miyata Received: 04/16/08 Massachusetts General Hospital, Boston, MA ----------------------------------------------------------------------------- Strain: AUM1054 Species: C. elegans Genotype: gsk-3(tm2223) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Description: Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile tm2223 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042. Mutagen: Outcrossed: x5x Made by: Tokiko Furuta Received: 07/12/18 MD Anderson Cancer Center - Univ of Texas, Houston, TX ----------------------------------------------------------------------------- Strain: AUM1535 Species: Caenorhabditis elegans Genotype: drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Description: [D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010. Mutagen: Crispr/Cas9 Outcrossed: x5 Made by: J. H. Seemann Received: 06/16/23 MD Anderson Cancer Center - Univ of Texas, Houston, TX ----------------------------------------------------------------------------- Strain: AUM1830 Species: Caenorhabditis elegans Genotype: sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Description: Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989. Mutagen: Outcrossed: x5 Made by: Tokiko Furuta Received: 06/16/23 MD Anderson Cancer Center - Univ of Texas, Houston, TX ----------------------------------------------------------------------------- Strain: AUM1863 Species: Caenorhabditis elegans Genotype: sart-3(tm15993)/tmC9 [F36H1.2(tmIs1221)] IV. Description: Homozygous lethal deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm15993 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. 93% of tm15993 homozygotes die before adulthood and those that escape are sterile. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989. Mutagen: Outcrossed: x5 Made by: Tokiko Furuta Received: 06/16/23 MD Anderson Cancer Center - Univ of Texas, Houston, TX ----------------------------------------------------------------------------- Strain: AUM1870 Species: C. elegans Genotype: ZK813.1(viz166[fln-1p::ZK813.1]) X. Description: The endogenous promoter of ZK813.1 (1046 bp) was replaced with the fln-1 promoter (947 bp) to limit the expression of ZK813.1 to the spermatheca and allow analysis of RNA transfer from soma to oocytes. Reference: Trimmer KA, et al. Cell Rep. 2023 May 23;42(6):112544. doi: 10.1016/j.celrep.2023.112544. PMID: 37227820. . Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Jake Seemann Received: 06/16/23 MD Anderson Cancer Center - Univ of Texas, Houston, TX ----------------------------------------------------------------------------- Strain: AUM2023 Species: Caenorhabditis elegans Genotype: daf-2(e1370) unc-119(ed3) III; vizIs23. Description: vizIs23 [pie-1p::GFP::daf-2(WT)::pie-1 3'UTR + unc-119(+)]. Maintain at 15C; pick superficially wild-type animals to avoid silencing of the transgene. pie-1 driven DAF-2 coding region with GFP transgene rescues the germline defects of daf-2(e1370). Slow growing. The transgene is sometimes silenced in the germline resulting in dauerunc animals at 25C. Reference: Lopez AL 3rd, et al. Dev Cell. 2013 Oct 28;27(2):227-40. Mutagen: Outcrossed: x2 Made by: Jessica (Jie) Chen Received: 08/15/14 MD Anderson Cancer Center - Univ of Texas, Houston, TX ----------------------------------------------------------------------------- Strain: AUM2059 Species: C. elegans Genotype: vizSi20 II; unc-119(ed3) III. Description: vizSi20 [mex-5p::GFP::gsk-3 (K65A,E77A,D161A,D180A)::tbb-2 3’UTR + unc-119(+)] II. Superficially wild-type. vizSi20 was inserted into Chr II ttTi5605 using MosSci. GSK-3 cDNA was rendered kinase dead by replacing K65, E77, D161 and D180 to alanine. The transgene does not rescue gsk-3 sterility or embryonic lethality defects. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042. Mutagen: Outcrossed: x3x Made by: Tokyo Furuta Received: 07/12/18 MD Anderson Cancer Center - Univ of Texas, Houston, TX ----------------------------------------------------------------------------- Strain: AUM2071 Species: C. elegans Genotype: vizSi32 II; unc-119(ed3) III. Description: vizSi32 [cdk-2p(intron)::GFP::tbb-2 3’ UTR + unc-119(+)] II. vizSi32 was inserted into ttTi5605 on Chr II using MosSci. Intron 1 of cdk-2 drives drives GFP expression in this transgene. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042. Mutagen: Outcrossed: x2x Made by: Tokyo Furuta Received: 07/12/18 MD Anderson Cancer Center - Univ of Texas, Houston, TX ----------------------------------------------------------------------------- Strain: AUM2073 Species: C. elegans Genotype: vizSi34 II; unc-119(ed3) III. Description: vizSi34 [cdk-2p::GFP::tbb-2 3’ UTR + unc-119(+)] II. Superficially wild-type. vizSi34 was inserted into ttTi5605 on Chr II using MosSci. Predicted cdk-2 promoter (from WormBase) drives GFP expression. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042. Mutagen: Outcrossed: x4x Made by: Tokyo Furuta Received: 07/12/18 MD Anderson Cancer Center - Univ of Texas, Houston, TX ----------------------------------------------------------------------------- Strain: AV106 Species: Caenorhabditis elegans Genotype: spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V). Description: Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc spo-11 homozygotes, and dead eggs (nT1 homozygotes). spo-11 homozygotes produce an average of ~200 fertilized eggs but only about 0.1 progeny survive to adulthood. When mated to N2 males, spo-11 homozygotes will produce at least 5-10 cross progeny. Mutagen: Diepoxybutane Outcrossed: x8 Made by: Abby Dernburg Received: 10/30/98 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV112 Species: Caenorhabditis elegans Genotype: mre-11(ok179) IV/nT1 [unc-?(n754) let-?] (IV;V). Description: Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc mre-11 homozygotes, and dead eggs (nT1 homozygotes). mre-11 homozygotes produce about 200 fertilized eggs but only about 2-3% of these eggs survive to adulthood (this mutation cannot be maintained in a homozygous condition). Occasionally non-Unc progeny that do not demonstrate the mre-11(ok179) mutant phenotype arise when grown in large liquid cultures. mre-11 is the predicted gene ZC302.1 Mutagen: Outcrossed: x Made by: Deletion Consortium Received: 12/04/00 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV115 Species: Caenorhabditis elegans Genotype: msh-5(me23) IV/nT1 [unc-?(n754) let-?] (IV;V). Description: Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc msh-5 homozygotes, and dead eggs (nT1 homozygotes). msh-5 homozygotes give 97.9% dead eggs; of those that hatch, 42% are male. Mutagen: EMS Outcrossed: x Made by: Received: 03/06/02 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV125 Species: Caenorhabditis elegans Genotype: spe-8(hc40) I; dpy-4(e1166) IV. Description: Can be maintained by chunking or setting up male/hermaphrodite crosses. Dpy. Mutagen: Outcrossed: x Made by: Gillian Stanfield Received: 10/30/06 University of Utah, Salt Lake City UT, USA ----------------------------------------------------------------------------- Strain: AV146 Species: Caenorhabditis elegans Genotype: chk-2(me64) rol-9(sc148)/unc-51(e369) rol-9(sc148) V. Description: Heterozygotes are fertile Rollers and segregate fertile non-Rollers (heterozygote), Unc Rollers (unc-51 homozygotes), and non-Unc Rollers that give 96-97% dead eggs (a high % of the survivors are males). Mutagen: Outcrossed: x Made by: Amy MacQueen Received: 07/11/01 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV157 Species: Caenorhabditis elegans Genotype: spo-11(me44)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Description: Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc spo-11(me44) homozygotes, and dead eggs (nT1 homozygotes). spo-11(me44) homozygotes are viable and produce more than 90% dead eggs (a large fraction of the survivors are males — strong Him phenotype); cytologically they lack chiasmata in diakinesis-stage oocytes and lack RAD-51 foci. Maintain by picking Unc. Mutagen: EMS Outcrossed: x>2 Made by: Gregory Chin Received: 08/27/07 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV221 Species: Caenorhabditis elegans Genotype: unc-119(ed3) meT8 (III); meIs4 meT8 (IV); meIs1. Description: meIs1 [pie-1p::GFP::lacI + unc-119(+)]. meIs4 [lac-O + rol-6(su1006) + lacO] IV. Pick Rol worms to maintain. This strain throws both Rol and non-Rol worms, seemingly due to random silencing of rol-6(su1006) in the lacO array, meIs4. The strain expresses GFP::LacI in the gonad and embryos that is observed as foci (of lacO target) and nuclear haze. The expression level of GFP::LacI occasionally becomes low possibly due to random silencing of meIs1. If this happens, heat shock the strain at 25°C for 3 days, and pick a clone that exhibits bright GFP signals. Even at the highest expression level, GFP signal is too weak to detect with a fluorescent dissection microscope, and it is necessary to use a regular compound fluorescent microscope with an oil immersion 60X or 100X objective. The NA of the objective should be higher than 1.4. Reference: Bilgir C, et al. G3 (Bethesda). 2013 Mar 11. pii: g3.112.005165v1. Mutagen: Outcrossed: x0 Made by: Kentaro Nabeshima Received: 04/30/14 University of Michigan, Ann Arbor, MI ----------------------------------------------------------------------------- Strain: AV267 Species: Caenorhabditis elegans Genotype: syp-3(me42)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Description: Heterozygotes are WT and GFP+. Segregate syp-3(me42) homozygotes that are non-GFP and lay mostly dead eggs; these mutants form abnormal synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable. Mutagen: EMS Outcrossed: x4 Made by: J Engebrecht Received: 09/28/07 Harvard Medical School, Boston, MA ----------------------------------------------------------------------------- Strain: AV271 Species: Caenorhabditis elegans Genotype: him-3(me80)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Description: Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc him-3(me80) homozygotes, and dead eggs (nT1 homozygotes). him-3(me80) homozygotes are viable and non-Unc. They produce more than 85% dead eggs and a large fraction (11%) of the survivors are males (Him phenotype). Cytologically they exhibit a reduced level of HIM-3 loading and fewer stretches of SYP-1 than WT. In diakinesis-stage oocytes, they contain a mixture of bivalents and univalents. Maintain by picking Unc. Mutagen: EMS Outcrossed: x>2 Made by: Kentaro Nabeshima Received: 08/27/07 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV276 Species: Caenorhabditis elegans Genotype: syp-2(ok307) V/nT1 [unc-?(n754) let-?(m435)] (IV;V). Description: Balanced heterozygotes are Unc and segregate Unc (heterozygotes), non-Unc syp-2(ok307) homozygotes, and dead eggs (nT1 homozygotes). syp-2(ok307) homozygotes are viable and non-Unc. They produce 96% dead eggs and 44% males; cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. Mutagen: UV/TMP Outcrossed: x6 Made by: Monica Colaiacovo Received: 09/16/04 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV280 Species: Caenorhabditis elegans Genotype: unc-119(e2498) III; him-17(ok424) V; meIs5. Description: meIs5 [him-17::GFP + unc-119(+)]. him-17::GFP is expressed in the germline. meIs5 not mapped. Mutagen: Microparticle Bombardment Outcrossed: x Made by: Kirthi Reddy Received: 09/16/04 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV285 Species: Caenorhabditis elegans Genotype: swm-1(me66) him-5(e1490) V. Description: Sperm activation in virgin males. Poor sperm transfer. Mutagen: EMS Outcrossed: x6 Made by: Gillian Stanfield Received: 05/25/06 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV307 Species: Caenorhabditis elegans Genotype: syp-1(me17) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Description: Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc syp-1(me17) homozygotes, and dead eggs (nT1 homozygotes). syp-1(me17) homozygotes produce 95% dead embryos and 38% males. Cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. Mutagen: EMS Outcrossed: x>2 Made by: Amy MacQueen Received: 09/25/03 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV308 Species: Caenorhabditis elegans Genotype: him-14(it21)/mnC1 [dpy-10(e128) unc-52(e444)] II. Description: Heterozygotes are wild-type and segregate wild-type heterozygotes, DpyUncs (mnC1 homozygotes), and him-14 homozygotes that produce >95% dead embryos and 45% males. Among these surviving progeny, cytologically they have 12 univalents in diakinesis-stage oocytes owing to a failure to form crossovers during meiosis. Mutagen: EMS Outcrossed: x Made by: Received: 11/04/05 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV311 Species: Caenorhabditis elegans Genotype: dpy-18(e364) unc-3(e151) meT7 (III;X;IV). Description: Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs. Mutagen: Outcrossed: x>1 Made by: Kenneth Hillers Received: 12/05/03 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV322 Species: Caenorhabditis elegans Genotype: swm-1(me87) him-5(e1490) V. Description: Sperm activation in virgin males. Very poor sperm transfer. Mutagen: EMS Outcrossed: x6 Made by: Gillian Stanfield Received: 05/25/06 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV38 Species: Caenorhabditis elegans Genotype: mnDp66 (X;I); meDf2 X. Description: Produces 31% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf2 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf2/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf2 can be followed in heterozygotes by this weak Him phenotype. Mutagen: Gamma Rays Outcrossed: x2 Made by: Anne Villeneuve Received: 06/16/97 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV39 Species: Caenorhabditis elegans Genotype: mnDp66 (X;I); meDf3 X. Description: Produces 32% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf3 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf3/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf3 can be followed in heterozygotes by this weak Him phenotype. Mutagen: Gamma Rays Outcrossed: x2 Made by: Anne Villeneuve Received: 06/16/97 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV40 Species: Caenorhabditis elegans Genotype: mnDp66 (X;I); meDf4 X. Description: Produces 27% XO male self progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf4 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf4/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf4 can be followed in heterozygotes by this weak Him phenotype. Mutagen: Gamma Rays Outcrossed: x2 Made by: Anne Villeneuve Received: 06/16/97 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV41 Species: Caenorhabditis elegans Genotype: mnDp66 (X;I); meDf5 X. Description: Produces 32% XO male self-progeny; nondisjunction is correlated with a high frequency of achiasmate X chromosomes in oocyte nuclei, and a reduced frequency of X chromosome crossovers. meDf5 disrupts the function of the cis-acting X chromosome meiotic pairing center. meDf5/+ heterozygotes produce 4-6% XO progeny, so the presence of meDf5 can be followed in heterozygotes by this weak Him phenotype. Mutagen: Gamma Rays Outcrossed: x2 Made by: Anne Villeneuve Received: 06/16/97 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV473 Species: Caenorhabditis elegans Genotype: rad-50(ok197) V/nT1 [qIs51] (IV;V). Description: qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok197 homozygotes (viable, sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. rad-50 homozygotes are viable, produce more than 95% dead eggs and a large fraction of the survivors are male (Him phenotype). Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Reference: Hayashi M, et al. PLoS Genet. 2007 Nov;3(11):e191. Mutagen: Outcrossed: x4 Made by: Michiko Hayashi Received: 04/07/15 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV477 Species: C. elegans Genotype: dsb-2(me96) II. Description: Age-dependent defect in meiotic double-strand break formation. Homozygous mutants produce elevated frequency of males and dead embryos resulting from defects in meiotic chromosome segregation. The frequency of both males and dead embryos increases in later broods. Reference: Rosu S, et al. PLoS Genet. 2013;9(8):e1003674. Mutagen: EMS Outcrossed: x4 Made by: Simona Rosu Received: 08/27/18 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV51 Species: Caenorhabditis elegans Genotype: me8 X. Description: Homozygotes produce 10-15% XO male self progeny; nondisjuction is correlated with an increased frequency of achiasmate X chromosomes in oocyte nuclei, and an unaltered distribution of X chromosome crossovers. Heterozygotes produce 1-2% male self-progeny. Homozygotes (and XO hemizygotes) are slower growing than WT; reduced male mating efficiency. me8 disrupts the function of the cis-acting X chromosome meiotic pairing center. Molecular studies show that the me8 chromosome carries a terminal deletion that removes >70 kb from the left end of the X chromosome, including the endogenous telomere; further, a segment of chromosome V has been translocated to the left end of X, and a new telomere has been added de novo to the end of the translocated segment. Mutagen: EMS Outcrossed: x4 Made by: Anne Villeneuve Received: 06/16/97 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV630 Species: Caenorhabditis elegans Genotype: meIs8 II. Description: meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Reference: Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87. Mutagen: Bombardment Outcrossed: x1 Made by: Rayka Yokoo Received: 04/12/12 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV828 Species: C. elegans Genotype: nbs-1(me102) meIs8/mIn1 [mIs14 dpy-10(e128)] II. Description: meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. Transgene contains a combination of cDNA and genomic sequences of cosa-1 including 212 bp of 3'UTR. GFP is expressed in the adult germline as 6 bright foci per nucleus (one per chromosome pair) from late pachytene through diplotene stages. Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. References: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Yokoo R, et al. Cell. 2012 Mar 30;149(1):75-87. Mutagen: EMS Outcrossed: x4 Made by: Chloe Girard, Baptiste Roelens, Karl A. Zawadzki Received: 12/28/18 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AV860 Species: C. elegans Genotype: nbs-1(me103)/mIn1 [mIs14 dpy-10(e128)] II. Description: Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP me103 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. nbs-1(me103) homozygotes have frayed and aggregated chromosomes at diakinesis of meiosis I. Reference: Girard C, et al. Proc Natl Acad Sci U S A. 2018 May 8;115(19):E4443-E4452. Mutagen: Crispr/Cas9 Outcrossed: x1 Made by: Chloe Girard Received: 12/28/18 Stanford University Medical School, Stanford, CA ----------------------------------------------------------------------------- Strain: AVS310 Species: Caenorhabditis elegans Genotype: artEx27. Description: artEx27 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion. Broad pattern of developmental GFP expression in the intestine, hypodermal seam cells, and neurons. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. Mutagen: Outcrossed: x0 Made by: Ritikas Das Received: 09/10/20 University of Rochester, Rochester, NY ----------------------------------------------------------------------------- Strain: AVS394 Species: C. elegans Genotype: artEx12. Description: artEx12 [hpk-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional fusion of hpk-1 promoter with GFP. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. Mutagen: Outcrossed: x0 Made by: Ritikas Das Received: 09/10/20 University of Rochester, Rochester, NY ----------------------------------------------------------------------------- Strain: AVS397 Species: C elegans Genotype: gpIs1; artEx35. Description: gpIs1 [hsp-16.2p::GFP]. artEx35 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick animals with red pharynx to maintain. Inducible GFP fluorescence after >1 hour heat shock. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. Mutagen: Outcrossed: x0 Made by: Ritikas Das Received: 09/10/20 University of Rochester, Rochester, NY ----------------------------------------------------------------------------- Strain: AVS408 Species: Caenorhabditis elegans Genotype: artEx31. Description: artEx31 [sur-5p::hpk-1::CFP + myo-2p::mCherry)]. Pick mCherry+ animals to maintain. sur-5 driven over-expression of hpk-1. Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. Mutagen: Outcrossed: x0 Made by: Ritikas Das Received: 09/10/20 University of Rochester, Rochester, NY ----------------------------------------------------------------------------- Strain: AVS411 Species: C elegans Genotype: artEx30. Description: artEx30 [hpk-1p::hpk-1::tdTomato + hsf-1p::hsf-1::GFP + rol-6 (su1006)]. Pick Rollers to maintain. Reference: Das R, PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. Mutagen: Outcrossed: x0 Made by: Ritikas Das Received: 09/10/20 University of Rochester, Rochester, NY ----------------------------------------------------------------------------- Strain: AVS413 Species: Caenorhabditis elegans Genotype: hpk-1(pk1393) X; artEx29. Description: artEx29 [hpk-1p::hpk-1::GFP + rol-6(su1006)]. Full-length C-terminal hpk-1::GFP fusion transgene rescues the progeric phenotype of hpk-1(pk1393). Reference: Das R, et al. PLoS Genet. 2017 Oct 16;13(10):e1007038. doi: 10.1371/journal.pgen.1007038. PMID: 29036198; PMCID: PMC5658188. Mutagen: Outcrossed: x9 Made by: Ritikas Das Received: 09/10/20 University of Rochester, Rochester, NY ----------------------------------------------------------------------------- Strain: AWR41 Species: C. elegans Genotype: lin-35(kea7[lin-35p::degron::GFP::lin-35]) I. Description: N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR45 Species: C. elegans Genotype: pals-22(kea8[pals-22::GFP::degron]) III. Description: C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR54 Species: C. elegans Genotype: lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi57 II. Description: ieSi57 [eft-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of eft-3p::TIR1::mRuby allows auxin-inducible degradation of LIN-35 in somatic tissues. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR56 Species: C. elegans Genotype: lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; ieSi64 II. Description: ieSi64 [gld-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of gld-1p::TIR1::mRuby allows for auxin inducible degradation of LIN-35 in the germline. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR58 Species: C. elegans Genotype: lin-35(kea7[lin-35p::degron::GFP::lin-35]) I; keaSi10 II. Description: keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. N-terminal degron::GFP tag was inserted into the endogenous lin-35 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of LIN-35 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: lin-35(kea7) is an N-terminal tag; the methods section of the paper incorrectly describes the tag as a C-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR59 Species: C. elegans Genotype: keaSi10 II; pals22(kea8[pals-22::GFP::degron]) III. Description: keaSi10 [rpl-28p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rpl-28::TIR1::mRuby allows auxin-inducible degradation of PALS-22 throughout the animal. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR61 Species: C. elegans Genotype: keaSi11 II; pals22(kea8[pals-22::GFP::degron]) III. Description: keaSi11 [vit-2p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of vit-2p::TIR1::mRuby allows for auxin inducible degradation in the adult intestine. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR62 Species: C. elegans Genotype: keaSi9 II; pals22(kea8[pals-22::GFP::degron]) III. Description: keaSi9 [myo-3p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of myo-3p::TIR1::mRuby allows for auxin inducible degradation in the body wall muscles. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR63 Species: C. elegans Genotype: keaSi12 II; pals22(kea8[pals-22::GFP::degron]) III. Description: keaSi12 [dpy-7p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of dpy-7p::TIR1::mRuby allows for auxin inducible degradation in the epidermis. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR64 Species: C. elegans Genotype: kea15 II; pals22(kea8[pals-22::GFP::degron]) III. Description: kea15 [rgef-1p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. C-terminal GFP::degron tag was inserted into the endogenous pals-22 locus. A single copy insertion of rgef-1p::TIR1::mRuby allows for auxin inducible degradation in neurons. Generated in N2 background. Reference: Willis AR, et al. Sci Adv. 2021 May 5;7(19):eabf3114. PMID: 33952520 [NOTE: pals22(kea8) is a C-terminal tag; the methods section of the paper incorrectly describes the tag as an N-terminal insertion.] Mutagen: Outcrossed: x3 Made by: Winnie Zhao Received: 05/19/21 University of Toronto ----------------------------------------------------------------------------- Strain: AWR73 Species: Caenorhabditis elegans Genotype: aaim-1(kea22) X. Description: aaim-1 mutants are resistant to infection by N. parisii, but sensitive to infection by Pseudomonas aeruginosa PA14. No defects in development or lifespan were observed. Reference: Tamim El Jarkass H, et al. eLife. 2022;11:e72458. PMID: 34994689. Mutagen: Outcrossed: x3 Made by: Hala Tamim El Jarkass Received: 02/04/22 University of Toronto ----------------------------------------------------------------------------- Strain: AX1295 Species: Caenorhabditis elegans Genotype: gcy-35(ok769) I. Description: Supresses aggregation and bordering phenotypes of npr-1(null) animals. Mutagen: UV/TMP Outcrossed: x5 Made by: Mario de Bono Received: 12/07/04 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX1296 Species: Caenorhabditis elegans Genotype: gcy-36(db42) X. Description: Supresses aggregation and bordering phenotypes of npr-1(null) animals. Mutagen: EMS Outcrossed: x8 Made by: Mario de Bono Received: 12/07/04 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX1297 Species: Caenorhabditis elegans Genotype: gcy-36(db66) X. Description: Supresses aggregation and bordering phenotypes of npr-1(null) animals. Mutagen: EMS Outcrossed: x8 Made by: Mario de Bono Received: 12/07/04 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX1305 Species: Caenorhabditis elegans Genotype: gcy-34(ok1012) V; npr-1(ad609) X. Description: Does not supress aggregation and bordering phenotypes of npr-1(null) animals. Mutagen: Outcrossed: x Made by: Mario de Bono Received: 12/07/04 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX1410 Species: Caenorhabditis elegans Genotype: flp-18(db99) X. Description: Impaired chemotaxis and foraging behavior. Excess intestinal fat accumulation. Reduced oxygen consumption. Derived from NL4000. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385. Mutagen: Outcrossed: x6 Made by: Merav Cohen Received: 10/11/24 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX1789 Species: Caenorhabditis elegans Genotype: dbEx719. Description: dbEx719 [npr-5::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in a subset of amphid neurons (ADF, ASE, ASG, ASI, ASJ, ASK, AWA, AWB), in the inner labial neuron IL2, in the interneurons AIA and AUA, and in the phasmids (PHA, PHB). Expression was also seen in head, neck, and body wall muscles. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385. Mutagen: Outcrossed: x6 Made by: Merav Cohen Received: 10/11/24 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX1791 Species: Caenorhabditis elegans Genotype: npr-5(ok1583) V; dbEx720. Description: dbEx720 [npr-5::npr-5(cDNA) + unc-122p::GFP]. Pick GFP+ to maintain. Intestinal fat accumulation is similar to wild-type. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385. Mutagen: Outcrossed: x0 Made by: Merav Cohen Received: 10/11/24 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX1792 Species: Caenorhabditis elegans Genotype: dbEx721. Description: dbEx721 [npr-4::mCherry + unc-122p::GFP]. Pick GFP+ to maintain. mCherry expression in the AVA and RIV neurons, possibly in BAG, in the tail neuron PQR, and in the BDU neurons. Expression was also seen in the coelomocytes, the intestine, and the rectal gland cells. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385. Mutagen: Outcrossed: x0 Made by: Merav Cohen Received: 10/11/24 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX2061 Species: Caenorhabditis elegans Genotype: dbEx813. Description: dbEx813 [gcy-37p::cGi500]. Pick GFP+ animals to maintain. The cGi500 cGMP sensor is expressed in the oxygen-sensing AQR, PQR, and URX neurons. Reference: Couto A, et al. Proc Natl Acad Sci U S A. 2013 Aug 27;110(35):E3301-10. Mutagen: Outcrossed: x0 Made by: Africa Couto Received: 10/27/14 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX2157 Species: Caenorhabditis elegans Genotype: tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx722. Description: dbEx722 [flp-17p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in BAG. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. Mutagen: Outcrossed: x0 Made by: Andrew Bretscher Received: 12/17/13 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX2159 Species: Caenorhabditis elegans Genotype: tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx723. Description: dbEx723 [gcy-32p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AQR, PQR, and URX. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. Mutagen: Outcrossed: x0 Made by: Andrew Bretscher Received: 12/17/13 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX2161 Species: Caenorhabditis elegans Genotype: tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx724. Description: dbEx724 [flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in ASE using an ASE-specific flp-6p fragment. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. Mutagen: Outcrossed: x0 Made by: Andrew Bretscher Received: 12/17/13 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX2164 Species: Caenorhabditis elegans Genotype: tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx725. Description: dbEx725 [gcy-8p::tax-2(cDNA)::SL2::GFP + gcy-32p::tax-2(cDNA)::SL2::GFP+ flp-17p::tax-2(cDNA)::SL2::GFP + flp-6p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD, AQR, PQR, URX, BAG, and ASE. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. Mutagen: Outcrossed: x0 Made by: Andrew Bretscher Received: 12/17/13 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX2178 Species: Caenorhabditis elegans Genotype: tax-2(p694) I; lin-15B&lin-15A(n765) X; dbEx726. Description: dbEx726 [gcy-8p::tax-2(cDNA)::SL2::GFP + lin-15(+)]. Pick non-Muv to maintain. Array rescues tax-2 in AFD. Reference: Bretscher AJ, et al. Neuron. 2011 Mar 24;69(6):1099-113. Mutagen: Outcrossed: x0 Made by: Andrew Bretscher Received: 12/17/13 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX301 Species: Caenorhabditis elegans Genotype: npr-1(ad609) lin-15B&lin-15A(n765) X; dbEx35. Description: dbEx35 [npr-1::GFP + lin-15(+)]. Pick Non-Muv to maintain. Solitary feeders. GFP is expressed in approximately 20 neuron types. Reference: Coates JC, de Bono M. 2002 Nature 419: 925-929. Mutagen: Outcrossed: x0 Made by: Juliet Coates Received: 10/08/13 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AX7884 Species: C. elegans Genotype: pod-2(syb1772[pod-2::His10]) II; mccc-1(syb1666[mccc-1::His10]) IV; pyc-1(syb1680[pyc-1::His10]) V; pcca-1(syb1626[pcca-1::His10]) X. Description: Superficially wild-type. Referred to as MP3-His. Strain can be used to biotinylated carboxylases from worm extracts. AX7884 obtained by crossing parental strains PHX1772 pod-2(syb1772[pod-2::His10]) II, PHX1666 mccc-1(syb1666[mccc-1::His10]) IV, PHX1680 pyc-1(syb1680[pyc-1::His10]) V and PHX1626 pcca-1(syb1626[pcca-1::His10]) X to obtain the quadruple His10-tagged strain. The 5xGlycine(G-linker)-His10 tag is a 45 bp sequence (GGAGGAGGAGGAGGACACCATCACCATCACCACCACCACCACCAC) encoding five glycine as a linker and ten histidine residues was knocked in at the C terminus-just upstream of the termination codon-of each of the four carboxylases. Reference: Artan M, et al. J Biol Chem. 2022 Aug 3:102343. doi: 10.1016/j.jbc.2022.102343. Epub ahead of print. PMID: 35933017. Mutagen: Outcrossed: x0 Made by: Murat Artan Received: 09/07/22 Institute of Science and Technology Austria, Klosterneuburg, Austria ----------------------------------------------------------------------------- Strain: AY1 Species: Caenorhabditis elegans Genotype: nol-6(ac1) II. Description: Temperature sensitive mutant. Grow at 15 to 20C. Sterile at 25C. Mutagen: EMS Outcrossed: x4 Made by: Alejandro Aballay Received: 10/06/09 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY101 Species: Caenorhabditis elegans Genotype: acIs101. Description: acIs101 [F35E12.5p::GFP + rol-6(su1006)]. Rollers. Reference: (2010) J Bio Chem 285(14):10832-40. Mutagen: Outcrossed: x4 Made by: Devin Bolz Received: 04/06/10 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY102 Species: Caenorhabditis elegans Genotype: pmk-1(km25) IV; acEx102. Description: acEx102 [vha-6p::pmk-1::GFP + rol-6(su1006)]. Maintain by picking Rollers. Reference: (2010) J Bio Chem 285(14):10832-40. Mutagen: Outcrossed: x0 Made by: Devin Bolz Received: 04/06/10 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY131 Species: C. elegans Genotype: zcIs4 V; vit-1(ac2) X. Description: zcIs4 [hsp-4::GFP] V. vit-1(ac2) is a dominant allele that causes ER stress. Since vit-1 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. Mutagen: EMS Outcrossed: x6 Made by: Jogender Singh Received: 06/27/19 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY132 Species: C. elegans Genotype: zcIs4 V; vit-2(ac3) X. Description: zcIs4 [hsp-4::GFP] V. vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. Mutagen: EMS Outcrossed: x6 Made by: Jogender Singh Received: 04/30/19 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY133 Species: C. elegans Genotype: zcIs4 V; vit-4(ac4) X. Description: zcIs4 [hsp-4::GFP] V. vit-4(ac4) is a dominant allele that causes ER stress. Since vit-4 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. Mutagen: EMS Outcrossed: x6 Made by: Jogender Singh Received: 06/27/19 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY134 Species: C. elegans Genotype: zcIs4 V; vit-5(ac5) X. Description: zcIs4 [hsp-4::GFP] V. vit-5(ac5) is a dominant allele that causes ER stress. Since vit-5 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. Mutagen: EMS Outcrossed: x6 Made by: Jogender Singh Received: 06/27/19 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY135 Species: C. elegans Genotype: zcIs4 V; vit-6(ac6) X. Description: zcIs4 [hsp-4::GFP] V. vit-6(ac6) is a dominant allele that causes ER stress. Since vit-6 is expressed only in adult stage, ER stress is induced only in adult stage. The levels of GFP expression from zcIs4 [hsp-4::GFP] reporter indicates the level of ER stress. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. Mutagen: EMS Outcrossed: x6 Made by: Jogender Singh Received: 06/27/19 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY142 Species: C. elegans Genotype: vit-2(ac3) X. Description: vit-2(ac3) is a dominant allele that causes ER stress. Since vit-2 is expressed only in adult stage, ER stress is induced only in adult stage. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. Mutagen: EMS Outcrossed: x6 Made by: Jogender Singh Received: 04/30/19 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY143 Species: C. elegans Genotype: flp-21(ok889) V; flp-18(gk3063) X. Description: Superficially wild-type. Reference: Singh J & Aballay A. Dev Cell. 2019 Apr 8;49(1):89-99.e4. Mutagen: Outcrossed: x0 Made by: Jogender Singh Received: 04/30/19 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY145 Species: Caenorhabditis elegans Genotype: kyIs262 IV; acEx24. Description: kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx24 [srbc-48p::srbc-48(cDNA) + unc-122::GFP]. Maintain by picking GFP+ to maintain array. Integrated RFP expression in AWB and AWC. Bright GFP expression in coelomocytes. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971 Mutagen: EMS Outcrossed: x6 Made by: Supender Kaur Received: 10/16/20 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY146 Species: Caenorhabditis elegans Genotype: kyIs262 IV; acEx25. Description: kyIs262 [unc-86::myr::GFP + odr-1::RFP] IV. acEx25 [odr-1p::srbc-48::GFP]. Maintain by picking GFP+ to maintain array. Extra-chromosomal GFP expression in AWC neurons. Integrated RFP expression in AWB and AWC. acEx25 rescues srbc-48 mediated defects. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971 Mutagen: EMS Outcrossed: x6 Made by: Supender Kaur Received: 10/16/20 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY147 Species: Caenorhabditis elegans Genotype: acEx26. Description: acEx26 [odr-1p::RFP]. Pick RFP+ to maintain. RFP expression in AWC and AWB. Reference: Kaur S & Aballay A. Cell Reports. 2020 May 19; 31(7): 107662. PMID: 32433971 Mutagen: No mutagen used Outcrossed: x0 Made by: Supender Kaur Received: 10/16/20 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY156 Species: Caenorhabditis elegans Genotype: acIs156. Description: acIs156 [vit-2p::vit-2(G839R)::GFP + myo-2p::mCherry]. In contrast to VIT-2::GFP, VIT-2(G839R)::GFP remains in the intestine and is not transported to embryos. mCherry expression in pharynx. Reference: Singh J & Aballay A. MBio. 2017 May 30;8(3). pii: e00778-17. doi: 10.1128/mBio.00778-17. Mutagen: integrated by UV Outcrossed: x6 Made by: Jogender Singh Received: 11/12/19 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY157 Species: C. elegans Genotype: gon-2(q388) I; acEx157. Description: acEx157 [gon-2p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in intestine and gonads). gon-2 expression driven by gon-2 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935 Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 09/16/21 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY158 Species: C. elegans Genotype: gon-2(q388) I; acEx158. Description: acEx158 [ges-1p::gon-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in intestinal cells). gon-2 expression driven by ges-1 promoter. Transgene rescues gon-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935 Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 09/16/21 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY159 Species: C. elegans Genotype: gtl-2(n2618) IV; acEx159. Description: acEx159 [gtl-2p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed primarily in the excretory cell and pharynx). gtl-2 expression driven by gtl-2 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935 Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 09/16/21 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY160 Species: C. elegans Genotype: gtl-2(n2618) IV; acEx160. Description: acEx160 [sulp-4p::gtl-2(cDNA)::SL2::GFP + unc-122::RFP]. Maintain by picking GFP+ or RFP+ animals (GFP is expressed in the excretory cell). gtl-2 expression driven by sulp-4 promoter. Transgene rescues gtl-2(lf). Reference: Filipowicz et al. eLife 2021;10:e65935. DOI: 10.7554/eLife.65935 Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 09/16/21 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY161 Species: Caenorhabditis elegans Genotype: mul-1(syb1027) IV. Description: F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ∼1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446 Mutagen: Crispr/Cas9 Outcrossed: x6 Made by: Casandra Hoffman Received: 09/16/21 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY162 Species: Caenorhabditis elegans Genotype: mul-1(syb1027) IV; acEx162. Description: acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx162 transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ∼1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446 Mutagen: Outcrossed: x6 Made by: Casandra Hoffman Received: 09/16/21 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY172 Species: C. elegans Genotype: mrp-1(pk89) X; acEx172. Description: acEx172 [mrp-1p::mrp-1C::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. mrp-1C (isoform C from cDNA) expressed under its own promoter rescues mrp-1. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 03/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY173 Species: C. elegans Genotype: mrp-1(pk89) X; acEx173. Description: acEx173 [mrp-1::GFP]. Pick GFP+ animals to maintain. Translationally fused MRP-1::GFP expressed under its own promoter rescues mrp-1. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 03/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY174 Species: C. elegans Genotype: mrp-1(pk89) X; acEx174. Description: acEx174 [ges-1p::mrp-1::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. Translational fusion of MRP-1::GFP driven by intestine-specific ges-1 promoter. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 03/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY175 Species: C. elegans Genotype: nmr-1(ak4) II; acEx175. Description: acEx175 [glr-1p::nmr-1::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. glr-1 promoter drives NMR-1 expression primarily in interneuron, neurons, and ventral nerve cord. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 03/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY176 Species: C. elegans Genotype: nmr-1(ak4) II; acEx176. Description: acEx176 [dc-1p::nmr-1::SL2::GFP + unc-122p::RFP]. Pick GFP+ or RFP+ animals to maintain. tdc-1 promoter drives NMR-1 expression primarily in RIM interneurons. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 03/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY177 Species: C. elegans Genotype: acEx177. Description: acEx177 [ges-1p::mrp-1::GFP + vha-6::DsRed + unc-122p::RFP]. Pick RFP+ to maintain. Translationally fused MRP-1::GFP expressed under intestinal specific ges-1 promoter, MRP-1::GFP proteins localize at the basolateral membrane of the intestine. Translationally fused VHA-6::RFP expressed under its own promoter, VHA-6::RFP proteins localize at the lumen or luminal membrane of the intestine. For better results, observe fluorescence signals on the L4 stage animals and also under higher magnification microscopy. Reference: Lalsiamthara J & Aballay A. Commun Biol. 2022 May 5;5(1):422. doi: 10.1038/s42003-022-03381-1. PMID: 35513700. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 03/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY178 Species: Caenorhabditis elegans Genotype: ynIs78; acEx178. Description: ynIs78 [flp-8p::GFP]. acEx178 [flp-8p::ced-3 (p15)::nz + flp-32::cz::ced-3 (p17) + unc-122p::RFP]. AUA interneurons ablated in flp-8p::GFP background. GFP-labelled AUA neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 04/04/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY179 Species: Caenorhabditis elegans Genotype: ynIs87; acEx179. Description: ynIs78 [flp-8p::GFP]. acEx179 [flp-21p::ced-3 (p15)::nz + ncs-1p::cz::ced-3 (p17) + unc-122p::RFP]. RMG interneurons ablated in flp-21p::GFP background. GFP-labelled RMG neurons are missing in the neuronal ablated animals. Pick RFP+ animals to maintain. Reference: Filipowicz A, et al. BMC Biol. 2022 Oct 8;20(1):229. doi: 10.1186/s12915-022-01424-x. PMID: 36209082. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 04/04/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY185 Species: C. elegans Genotype: acEx185. Description: acEx185 [hsp-16.41p::par-5::VN173 + hsp-16.41p::his-1::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. BiFC reporter strain for PAR-5 and histone (H4) proteins interaction. To detect the protein-protein physical interactions, heat shock the animals for 3 hours at 33°C, allow them to recover for 12 hours at 20°C, and observe fluorescent-complementation signals under a high-magnification fluorescence microscope. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 03/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY186 Species: C. elegans Genotype: acEx186. Description: acEx186 [hsp-16.41p::par-5::VN173 + hsp-16.41p::VC155 + unc-122p::RFP]. Pick RFP+ animals to maintain. Control strain for AY185 strain. Heat shock induces protein expression but NO BiFC complementation. Reference: Hong C, et al. PLoS Biol. 2021 Mar 31;19(3):e3001169. doi: 10.1371/journal.pbio.3001169. PMID: 33788830. Mutagen: Outcrossed: x0 Made by: Jonathan Lalsiamthara Received: 03/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY187 Species: C elegans Genotype: nhr-8(ok186) IV; acEx187. Description: acEx187 [vha-6p::nhr-8::SL2::GFP + rol-6(su1006)]. Pick Rollers to maintain (GFP expression in intestine is easy to see and might be easier to score than Rol). Intestinal rescue of nhr-8(ok186) mutants. Reference: Otarigho B & Aballay A. 2020. iScience. 2020 May 22;23(5):101068. doi: 10.1016/j.isci.2020.101068. PMID: 32361270. Mutagen: Outcrossed: x0 Made by: Benson Otarigho Received: 11/15/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY188 Species: C elegans Genotype: unc-30(ok613) IV; acEx188. Description: acEx188 [unc-30(+) + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by its own promoter rescues unc-30(ok613). Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721. Mutagen: none Outcrossed: x0 Made by: Benson Otarigho Received: 11/10/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY189 Species: C. elegans Genotype: unc-30(ok613) IV; acEx189. Description: acEx189 [rab-3p::unc-30 + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by rab-3 neuronal promoter rescues unc-30(ok613) in neurons. Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721. Mutagen: N/A Outcrossed: x0 Made by: Benson Otarigho Received: 11/10/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY190 Species: C. elegans Genotype: acEx190. Description: acEx190 [tax-2p::CZ::ced-3(p17)::unc-54 3’UTR + lim-6p::ced-3(p15)::NZ::unc-54 3’UTR + myo-3p::mCherry]. Pick mCherry+ to maintain.  ASG is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the tax-2 and lim-6 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721. Mutagen: N/A Outcrossed: x0 Made by: Benson Otarigho Received: 11/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AY191 Species: C elegans Genotype: acEx191. Description: acEx191 [odr-2p::CZ::ced-3(p17)::unc-54 3’UTR+ unc-53p::ced-3(p15)::NZ::unc-54 3’UTR + rol-6(su1006)]. Pick Rollers to maintain.  PVP is ablated in animals carrying the array by employing a two-component system reconstituted caspase (recCaspase) using the odr-2 and unc-53 promoters.  Strain viable at all temperatures.  Reference Otarigho, B. and Aballay, A., 202. Cell reports, 35(8). PMID: 34038721. Mutagen: N/A Outcrossed: x0 Made by: Benson Otarigho Received: 11/29/23 MD Anderson Cancer Center, Houston, TX ----------------------------------------------------------------------------- Strain: AZ212 Species: Caenorhabditis elegans Genotype: unc-119(ed3) ruIs32 III. Description: ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Homozygous expression of GFP::H2B histone fusion in germline. pAZ132. Mutagen: Microparticle Bombardment Outcrossed: x0 Made by: Vida Praitis Received: 05/07/01 University of Chicago, IL ----------------------------------------------------------------------------- Strain: AZ217 Species: Caenorhabditis elegans Genotype: unc-119(ed3) ruIs37 III. Description: ruIs37 [myo-2p::GFP + unc-119(+)] III. Expresses GFP in the pharynx. pAZ119. Mutagen: Microparticle Bombardment Outcrossed: x0 Made by: Vida Praitis Received: 05/17/01 University of Chicago, IL ----------------------------------------------------------------------------- Strain: AZ218 Species: Caenorhabditis elegans Genotype: unc-119(ed3) ruIs38 III. Description: ruIs38 [partial myo-2 promoter::GFP + unc-119(+)]. Expresses GFP in the pharynx. pAZ119. Mutagen: Microparticle Bombardment Outcrossed: x0 Made by: Vida Praitis Received: 05/17/01 University of Chicago, IL ----------------------------------------------------------------------------- Strain: AZ235 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; ruIs48. Description: ruIs48 [pie-1::tubulin::GFP + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147. Mutagen: Microparticle Bombardment Outcrossed: x0 Made by: Vida Praitis Received: 05/07/01 University of Chicago, IL ----------------------------------------------------------------------------- Strain: AZ244 Species: Caenorhabditis elegans Genotype: unc-119(ed3) III; ruIs57. Description: ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Homozygous expression of GFP::tubulin fusion in germline and early embryos. Insertion unmapped. pAZ147. Mutagen: Microparticle Bombardment Outcrossed: x0 Made by: Vida Praitis Received: 05/07/01 University of Chicago, IL ----------------------------------------------------------------------------- Strain: AZ30 Species: Caenorhabditis elegans Genotype: sma-1(ru18) V. Description: Strong Sma phenotype. Null allele.  NOTE: Some animals Roll Mutagen: UV/Psoralen Outcrossed: x3 Made by: Vida Praitis Received: 05/07/01 University of Chicago, IL ----------------------------------------------------------------------------- Strain: BA1 Species: Caenorhabditis elegans Genotype: fer-1(hc1) I. Description: Temperature sensitive. M-MATING+LOW TEMP ONLY. Recessive. Fertilization abnormal. Mutagen: EMS Outcrossed: x Made by: Ward S Received: 03/01/80 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: BA1013 Species: Caenorhabditis elegans Genotype: spe-6(hc49) vab-7(e1562)/qC1 [dpy-19(e1259) glp-1(q339)] III; spe-27(it132) IV. Description: Male/hermaphrodite line. Maintain at 15C to insure maintenance of male/hermaphrodite line. Mutagen: Outcrossed: x Made by: Paul Muhlrad Received: 02/28/05 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1044 Species: Caenorhabditis elegans Genotype: spe-27(it132) spe-29(it127) IV; him-5(e1490) V. Description: Non-conditional hermaphrodite sterile. Males fertile. Self-progeny produced after mating. Mutagen: Outcrossed: x Made by: Jeremy Nance Received: 01/05/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1051 Species: Caenorhabditis elegans Genotype: spe-12(hc76) I; spe-29(it127) IV; him-5(e1490) V. Description: Self-sterile hermaphrodites; fertile males. Mated hermaphrodites produce self and outcross progeny. Self progeny are 33% males. Mutagen: Outcrossed: x Made by: Jeremy Nance Received: 01/05/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1061 Species: Caenorhabditis elegans Genotype: dpy-18(e364) spe-6(hc49) ale-1(mc14)/qC1 [dpy-19(e1259) glp-1(q339)] III. Description: Heterozygotes are WT and segregate WT, Sterile Dpys (Dpy is temperature sensitive), and dead eggs. ale-1 is a recessive embryonic lethal. Mutagen: Outcrossed: x Made by: Paul Muhlrad Received: 02/28/05 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1069 Species: Caenorhabditis elegans Genotype: F26F4.8(hc180) III. Description: Deletion allele of F26F4.8. Homologous to Zn finger of Drosophila ovo transcription factor. Developmental defects in hind gut, germline and vulva. HES primers 106/107 outer and HES 108/109 inner. Mutagen: UV/TMP Outcrossed: x6 Made by: H. Smith Received: 10/15/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1070 Species: Caenorhabditis elegans Genotype: cdh-5(hc181) IV. Description: Deletion allele of F08B4.2. Homologous to Drosophila fat cadherin. Primers HES 114/115 outer and HES 116/117 inner. Mutagen: UV/TMP Outcrossed: x2 Made by: H. Smith Received: 10/15/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1073 Species: Caenorhabditis elegans Genotype: dyf-5(hc183) I. Description: Deletion allele of M04C9.5 (mak-kinase). No visible phenotype in hermaphrodites. Primers HES 186/187 outer and HES 188/189 inner. Mutagen: Outcrossed: x0 Made by: H. Smith Received: 10/15/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1083 Species: Caenorhabditis elegans Genotype: F43G6.6(hc184) II. Description: Deletion allele of F43G6.6. No obvious phenotype in hermaphrodites. HES primers 162/163 outer and 164/165 inner. Mutagen: UV/TMP Outcrossed: x0 Made by: H. Smith Received: 10/15/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1084 Species: Caenorhabditis elegans Genotype: F09C12.2(hc185) II. Description: Deletion allele of F09C12.2. No obvious phenotype in hermaphrodites. HES primers 122/123 outer and HES 124/125 inner. Mutagen: UV/TMP Outcrossed: x0 Made by: H. Smith Received: 10/15/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1090 Species: Caenorhabditis elegans Genotype: cav-2(hc191) V. Description: No visible phenotype in hermaphrodites. Deletion allele of C56A3.7. Mutagen: TMP Outcrossed: x6 Made by: HES Received: 07/26/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1091 Species: Caenorhabditis elegans Genotype: C35D10.2(hc192) III. Description: No visible phenotype in hermaphrodites. Primes HES 146/146 and HES 148/149. Mutagen: TMP Outcrossed: x6 Made by: HES Received: 10/23/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA1093 Species: Caenorhabditis elegans Genotype: snf-10(hc194) V. Description: Y32F6A.2 No visible phenotype in hermaphrodites. Primers: outer HES 22/228 and inner HES 229/230. Mutagen: TMP Outcrossed: x6 Made by: H. Smith Received: 10/15/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA14 Species: Caenorhabditis elegans Genotype: fer-14(hc14) X. Description: Temperature sensitive. 8% of total oocytes produced are fertilized and give rise to larvae at 16C. Almost completely sterile at 25C. Mutagen: EMS Outcrossed: x2 Made by: Tom Roberts Received: 11/01/84 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA15 Species: Caenorhabditis elegans Genotype: rrf-3(hc15) II. Description: Temperature sensitive. Maintain at 15C. Mutagen: EMS Outcrossed: x2 Made by: Tom Roberts Received: 11/01/84 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA17 Species: Caenorhabditis elegans Genotype: fem-1(hc17) IV. Description: Temperature sensitive. Recessive. Feminization. Mutagen: EMS Outcrossed: x Made by: Nelson G Received: 03/01/80 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: BA2 Species: Caenorhabditis elegans Genotype: fer-2(hc2) III. Description: Temperature sensitive. Maintain at 15C. Some growth at 20C. Does not grow at 25C. Recessive. Mutagen: EMS Outcrossed: x Made by: Ward S Received: 03/01/80 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: BA23 Species: Caenorhabditis elegans Genotype: fer-6(hc23) I. Description: Temperature sensitive. Fertilization abnormal. Recessive. Mutagen: EMS Outcrossed: x Made by: Ward S Received: 03/01/80 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: BA24 Species: Caenorhabditis elegans Genotype: fer-1(hc24) I. Description: Fertilization abnormal. Recessive. Leaky temperature sensitive. Mutagen: EMS Outcrossed: x Made by: Ward S Received: 03/01/80 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: BA3 Species: Caenorhabditis elegans Genotype: eri-3(hc3) II. Description: Temperature sensitive. Fertilization abnormal. Recessive. Mutagen: EMS Outcrossed: x Made by: Ward S Received: 03/01/80 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: BA34 Species: Caenorhabditis elegans Genotype: fer-7(hc34) I. Description: Fertilization abnormal. Recessive. Temperature sensitive. Maintain at 15C. Very leaky: grows at 20C and also somewhat at 25.4C to 25.8C. Mutagen: EMS Outcrossed: x Made by: Ward S Received: 03/01/80 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: BA4 Species: Caenorhabditis elegans Genotype: fer-4(hc4) V. Description: Fertilization abnormal. Recessive. Temperature sensitive. Maintain at 15C. Some growth at 20C and 25.4 C. Mutagen: EMS Outcrossed: x Made by: Ward S Received: 03/01/80 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: BA521 Species: Caenorhabditis elegans Genotype: fer-1(hc1) unc-29(e1072) I. Description: Temperature sensitive. Maintain at 15C. Unc. Mutagen: Outcrossed: x Made by: Received: 02/01/86 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA522 Species: Caenorhabditis elegans Genotype: fer-1(hc13) unc-29(e1072) I. Description: Temperature sensitive. Maintain at 15C. Unc. Mutagen: EMS Outcrossed: x Made by: Received: 02/01/86 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA524 Species: Caenorhabditis elegans Genotype: fer-1(hc1) I; him-5(e1490) V. Description: Temperature sensitive. Maintain at 15C. Throws males. Mutagen: Outcrossed: x Made by: Y. Argon Received: 11/01/84 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA547 Species: Caenorhabditis elegans Genotype: fer-2(hc2) III; him-5(e1490) V. Description: Fertile at 16c and 20C. Sterile at 25C-Produces some defective embryos and 0-5 progeny. Throws males. Mutagen: Outcrossed: x Made by: Received: 11/01/84 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA562 Species: Caenorhabditis elegans Genotype: fer-4(hc4) him-5(e1490) V. Description: Temperature sensitive. Maintain at 15C. Produces about 30% males. Mutagen: Outcrossed: x Made by: Steve L'Hernault Received: 11/01/84 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA585 Species: Caenorhabditis elegans Genotype: spe-10(hc104) unc-76(e911) V. Description: Unc. Temperature sensitive, maintain at 16C. Average progeny: at 16C= 7 +/- 5; at 25C= 0.1 +/- .1. Mutagen: EMS Outcrossed: x Made by: Steve L'Hernault Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA590 Species: Caenorhabditis elegans Genotype: spe-10(hc104) dpy-11(e224) V. Description: Dpy. Temperature sensitive, maintain at 16C. Average progeny at 16C= 7 +/- 5. At 25C, average progeny = 0.1 =/- .1. Mutagen: EMS Outcrossed: x Made by: Steve L'Hernault Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA6 Species: Caenorhabditis elegans Genotype: fer-6(hc6) I. Description: Fertilization abnormal. Temperature sensitive. Recessive. Mutagen: EMS Outcrossed: x Made by: Ward S Received: 03/01/80 University of Minnesota, Minneapolis, MN ----------------------------------------------------------------------------- Strain: BA606 Species: Caenorhabditis elegans Genotype: spe-6(hc49) unc-25(e156) III; eDp6 (III;f). Description: Animals with the Duplication are WT. Animals without the Duplication are Unc and Sterile. Mutagen: EMS Outcrossed: x10 Made by: Steve L'Hernault Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA609 Species: Caenorhabditis elegans Genotype: spe-6(hc49) vab-7(e1562) III; eDp6 (III;f). Description: Animals with the Duplications are WT. Animals which have lost the Duplication are Sterile and have an abnormal tail. Mutagen: EMS Outcrossed: x10 Made by: Steve L'Hernault Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA671 Species: Caenorhabditis elegans Genotype: spe-9(hc88) I. Description: Self-sterile at 25C. Maintain at 15C. Mutagen: EMS Outcrossed: x>2 Made by: Diane Shakes Received: 11/01/94 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA676 Species: Caenorhabditis elegans Genotype: spe-6(hc92) unc-32(e189) III; eDp6 (III;f). Description: Unc. Animals which have lost the duplications are Sterile and Unc. Mutagen: EMS Outcrossed: x15 Made by: Diane Shakes Received: 01/11/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA708 Species: Caenorhabditis elegans Genotype: spe-9(hc52) I. Description: Maintain at 15C. Mutagen: EMS Outcrossed: x Made by: Received: 06/15/88 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA709 Species: Caenorhabditis elegans Genotype: fer-1(hc80) unc-29(e1072)/sDf6 I. Description: Heterozygotes are WT and segregate WT heterozygotes, Sterile Unc (fer-1 unc-29 homozygotes) and L1 lethals (sDf6 homozygotes). hc80 is a nonconditional sterile. hc80 sperm have short pseudopods. Mutagen: EMS Outcrossed: x>3 Made by: Steve L'Hernault Received: 10/17/94 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA714 Species: Caenorhabditis elegans Genotype: sDf5/spe-4(hc78) I. Description: Heterozygotes are WT and segregate WT heterozygotes, Sterile spe-4 homozygotes, and dead eggs (sDf5 homozygotes). Mutagen: EMS Outcrossed: x Made by: Steve L'Hernault Received: 06/15/88 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA717 Species: Caenorhabditis elegans Genotype: spe-11(hc90) I; sDp2 (I;f). Description: Animals carrying the duplication WT. Animals which have lost the Dup are sterile. Maintain by picking fertile animals and checking for segregation of fertile and sterile progeny. Mutagen: EMS Outcrossed: x Made by: Received: 06/15/88 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA744 Species: Caenorhabditis elegans Genotype: spe-10(hc104) V. Description: Temperature sensitive, maintain at 15C. Average progeny at 16C is 7 +/- 5. Average progeny at 25C is 0.1 +/- .1. Mutagen: EMS Outcrossed: x Made by: Diane Shakes Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA759 Species: Caenorhabditis elegans Genotype: hcDf1 IV; eEx25. Description: eEx25 [C13G4(cosmid) + XDM23(phage)]. Animals with eEx25 are WT. Pick wild-type to maintain. Animals which have lost eEx25 are Twitchers and Sterile (occasionally produce young). This cosmid lacks the 3' end of the unc-22 gene while XDM23 lacks the 5' end of unc-22, but following injection an extrachromosomal array was formed that included at least one functional unc-22 gene. Mutagen: Spontaneous in TR466 Outcrossed: x Made by: Steve L'Hernault Received: 11/01/94 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA763 Species: Caenorhabditis elegans Genotype: spe-5(hc93) I; sDp2 (I;f). Description: Animals with the Duplications are WT. Animals which have lost the Duplication are Sterile. Mutagen: EMS Outcrossed: x Made by: Received: 06/15/88 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA782 Species: Caenorhabditis elegans Genotype: spe-10(hc104) him-5(e1490) V. Description: Temperature sensitive, maintain at 16C. Segregates males. Average progeny at 16C is 7 +/- 5. Average progeny at 25C is 0.1 +/- .1. Mutagen: EMS Outcrossed: x Made by: Diane Shakes. Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA783 Species: Caenorhabditis elegans Genotype: spe-12(hc76) I. Description: Maintain by mating. Hermaphrodites produce nonfunctional sperm and are fertilization defective. Self-fertility is <1% at 16C or 25C. Males are fertile. Mutagen: EMS Outcrossed: x Made by: Steve L'Hernault Received: 06/15/88 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA784 Species: Caenorhabditis elegans Genotype: spe-8(hc50) I. Description: Male-hermaphrodite mating strain. Males are fertile, hermaphrodites are sterile. Mutagen: Steve L'Hernault Outcrossed: x Made by: EMS Received: 01/05/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA785 Species: Caenorhabditis elegans Genotype: spe-8(hc40) I. Description: Hermaphrodites produce nonfunctional, nonmotile sperm with uniformly aberrant pseudopods. Male sperm normal. Self-fertility is <1% at 16C or 25C. Maintain by mating. Mutagen: EMS Outcrossed: x Made by: Received: 06/15/88 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA786 Species: Caenorhabditis elegans Genotype: spe-8(hc53) I. Description: Male-hermaphrodite mating strain. Males are fertile, hermaphrodites are sterile. Mutagen: Steve L'Hernault Outcrossed: x Made by: EMS Received: 01/05/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA793 Species: Caenorhabditis elegans Genotype: spe-26(hc138) dpy-13(e184) IV. Description: Temperature sensitive. Fertile at 16C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Made by: Jacob Varkey Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA794 Species: Caenorhabditis elegans Genotype: spe-13(hc137) I. Description: Temperature sensitive. Maintain at 15C. Mutagen: EMS Outcrossed: x Made by: Received: 06/15/88 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA811 Species: Caenorhabditis elegans Genotype: sDf5/spe-4(hc78) unc-15(e73) I. Description: Heterozygotes are WT and segregate WT heterozygotes, Sterile Unc spe-4 unc-15 homozygotes, and dead eggs (sDf5 homozygotes). Pick wild-type to maintain. Mutagen: EMS Outcrossed: x Made by: Steve L'Hernault Received: 06/15/88 Emory University, Atlanta, GA ----------------------------------------------------------------------------- Strain: BA819 Species: Caenorhabditis elegans Genotype: spe-11(hc77) I. Description: Temperature sensitive sterile. Paternal effect embryonic lethal. Permissive temp is 20C. Restrictive temp is 25C. Mutagen: Outcrossed: x>4 Made by: Diane Shakes Received: 10/17/94 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA821 Species: Caenorhabditis elegans Genotype: spe-26(hc138) IV. Description: Temperature-sensitive. Maintain at 15C. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage. Increase lifespan in males and hermaphrodites. Mutagen: EMS Outcrossed: x15 Made by: Jacob Varkey Received: 01/11/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA824 Species: Caenorhabditis elegans Genotype: spe-26(hc139) dpy-20(e1282) IV. Description: Temperature sensitive. Partially fertile at 16C (very few progeny). Sterile at 20C and 25C. Weak Dpy at 15C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Made by: Jacob Varkey Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA825 Species: Caenorhabditis elegans Genotype: spe-26(hc140) dpy-20(e1282)/+ IV. Description: Heterozygotes are WT and segregate wild-type, wild-type heterozygotes, and Sterile Dpy (spe-4 dpy-20 homozygotes). Homozygous mutants are weak Dpy and partially fertile at 15C. Sterile at 20-25C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Made by: Jacob Varkey Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA836 Species: Caenorhabditis elegans Genotype: spe-26(it112) unc-22(e66) IV. Description: Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x10 Made by: Diane Shakes Received: 01/11/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA837 Species: Caenorhabditis elegans Genotype: spe-26(it112) IV. Description: Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x10 Made by: Diane Shakes Received: 01/11/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA838 Species: Caenorhabditis elegans Genotype: spe-26(hc140) IV. Description: Temperature sensitive. Weak Dpy and partial fertility at 15C (very few progeny). Sterile at 20C and 25C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Made by: Jacob Varkey Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA839 Species: Caenorhabditis elegans Genotype: spe-26(it118) unc-22(e66) IV. Description: Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x10 Made by: Diane Shakes Received: 01/11/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA840 Species: Caenorhabditis elegans Genotype: spe-26(hc139) IV. Description: Temperature sensitive. Few progeny at 16C. Sterile at 20C and 25C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Made by: Jacob Varkey Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA843 Species: Caenorhabditis elegans Genotype: spe-26(it118) IV. Description: Temperature-sensitive. Fertile at 15C. Partially fertile at 20C. Sterile at 25C. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x10 Made by: Diane Shakes Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA883 Species: Caenorhabditis elegans Genotype: spe-12(hc152) I. Description: Male-hermaphrodite mating strain. Males are fertile, hermaphrodites are sterile. Mutagen: Outcrossed: x Made by: Received: 01/05/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA900 Species: Caenorhabditis elegans Genotype: spe-27(it110) IV. Description: Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps, males fertile. Spermatids activate "normally" in TEA. In pronase they produce spikes but never form pseudopods. Similar to spe-12 and spe-8. Mutagen: EMS Outcrossed: x Made by: Diane Shakes Received: 08/16/96 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA901 Species: Caenorhabditis elegans Genotype: spe-27(it110) dpy-20(e1282) IV. Description: Temperature sensitive Dpy. Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile. Spermatids arrest with spikes in pronase; form normal pseudopods in TEA. Mutagen: Outcrossed: x Made by: Received: 08/16/96 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA925 Species: Caenorhabditis elegans Genotype: spe-26(hc138) dpy-20(e1282) IV. Description: Temperature-sensitive. Fertile and weak Dpy at 15C. Partially fertile at 20C. Sterile at 25C. Twitcher. Spermatogenesis arrests at the spermatocyte stage. Mutagen: EMS Outcrossed: x15 Made by: Jacob Varkey Received: 02/03/93 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA947 Species: Caenorhabditis elegans Genotype: spe-27(hc161) IV. Description: Male/hermaphrodite mating strain. Hermaphrodites self-sterile at all temps; males fertile. Mutagen: EMS Outcrossed: x6 Made by: Alicia Minniti Received: 08/16/96 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA959 Species: Caenorhabditis elegans Genotype: spe-29(it127) dpy-20(e1282) IV. Description: Homozygous male/hermaphrodite line. Males are fertile. Hermaphrodites are sterile, but slightly leaky producing a few progeny (at 25C - ts not tested). In pronase, spermatids from males activate to form many long spikes, terminating at this stage. A very few (1-3 per worm) activate to form normal-looking, motile spermatozoons. Mutagen: Outcrossed: x Made by: Received: 01/05/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA962 Species: Caenorhabditis elegans Genotype: spe-29(it127) IV. Description: Hermaphrodites are sterile; Males are fertile. Hermaphrodites lay oocytes (produce a few fertile eggs and many oocytes). Produce viable progeny when mated to males. Hermaphrodites produce 10X more self progeny at 20C (2.5/herm) than at either 16C or 25C. Mutagen: Outcrossed: x3 Made by: Jeremy Nance Received: 01/05/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA963 Species: Caenorhabditis elegans Genotype: spe-27(it132) IV. Description: Temperature sensitive spe-27 allele. Hermaphrodites are sterile at 25C but produce 30-40 progeny/hermaphrodite at 16C. Males are fertile. Mutagen: EMS Outcrossed: x Made by: Received: 08/16/96 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA966 Species: Caenorhabditis elegans Genotype: spe-27(it132) unc-22(e66) IV. Description: Temperature sensitive spe-27 allele. Hermaphrodites sterile at 25C; hermaphrodites produce 30-40 progeny/hermaphrodite at 16C. Males cannot mate due to the unc-22 mutation. Maintain at 15C. Mutagen: Outcrossed: x Made by: Paul Muhlrad Received: 08/16/96 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA968 Species: Caenorhabditis elegans Genotype: spe-29(it127) unc-24(e138) IV. Description: Unc. Leaky sterile at 20C; tighter at 16C and 25C. Easier to propagate as if male-female strain. Mutagen: Outcrossed: x Made by: Jeremy Nance Received: 01/05/01 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA969 Species: Caenorhabditis elegans Genotype: spe-6(hc163) III; spe-27(it132) dpy-20(e1282) IV. Description: Dpy. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C. Mutagen: EMS (hc163) Outcrossed: x5 Made by: Paul Muhlrad Received: 07/29/03 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA970 Species: Caenorhabditis elegans Genotype: spe-6(hc163) III; spe-27(it132) unc-22(e66) IV. Description: Twitcher Unc. spe-6(hc163) is a recessive suppressor of spe-27(it132). spe-6(hc163) also suppresses spe-8, spe-12, spe-29 and other spe-27 alleles. Causes precocious spermatid activation. Fertile between 15-25C. Mutagen: EMS (hc163) Outcrossed: x4 Made by: Paul Muhlrad Received: 07/29/03 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA971 Species: Caenorhabditis elegans Genotype: spe-27(it132) dpy-20(e1282) IV. Description: Temperature sensitive spe-27 allele. Leaky sterile at 20C. Males at 20C produce spermatids that form spikes in pronase. Males are fertile. Temperature sensitive dpy-20 allele. Maintain at 15C. Mutagen: Outcrossed: x Made by: Received: 08/16/96 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA975 Species: Caenorhabditis elegans Genotype: spe-6(hc163) III; spe-29(it127) dpy-20(e1282) IV. Description: spe-6(hc163) suppresses the self-sterility of spe-29 in this strain. Self-sterile at 25C. Mutagen: Outcrossed: x Made by: Paul Muhlrad Received: 02/28/05 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA979 Species: Caenorhabditis elegans Genotype: dpy-5(e61) spe-12(hc76) I; spe-6(hc163) III. Description: spe-6(hc163) suppresses hermaphrodite self-sterility of hc76. Dpy. Mutagen: Outcrossed: x Made by: Paul Muhlrad Received: 02/28/05 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA984 Species: Caenorhabditis elegans Genotype: spe-6(hc163) dpy-18(e364) III. Description: Dpy. spe-6(hc163) suppresses self-sterility of spe-8, spe-12, spe-27, and spe-29 mutants. Causes precocious spermatide activation. Fertile between 15-25C. Mutagen: EMS (hc163) Outcrossed: x Made by: Paul Muhlrad Received: 07/29/03 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BA989 Species: Caenorhabditis elegans Genotype: spe-6(hc163) III; spe-27(it132) IV. Description: spe-6(hc163) suppresses the ts self-sterile phenotype of spe-27(it132). Also suppresses spe-8, spe-12, and spe-29. Causes precocious spermatid activation. Lays eggs and oocytes. Males are weakly fertile. Fertile between 15-25C. Mutagen: EMS (hc163) Outcrossed: x Made by: Paul Muhlrad Received: 07/29/03 University of Arizona, Tucson, AZ ----------------------------------------------------------------------------- Strain: BAY7 Species: C. elegans Genotype: yanSi1 II; unc-119(ed3) III. Description: yanSi1 [eft-3p::dCAS9::VP64::tbb-2 3'UTR + Cbr-unc-119(+)] inserted into ttTi5605 (II:8.42 MB) in parental strain EG6699. Integration plasmid was generated via 3-way gateway reaction with pCFJ150 and plasmids containing eft-3 promoter (ID:1031@E02 promoterome), tbb-2 3'UTR (pCM1.36), and a full length dcas9::VP64 transgene cloned into pDONR201. Reference: Zullo JM, et al. Nature. 2019 Oct;574(7778):359-364. doi: 10.1038/s41586-019-1647-8. PMID: 31619788. Mutagen: Outcrossed: x0 Made by: Joe Zullo Received: 08/27/24 Harvard Medical School, Boston, MA ----------------------------------------------------------------------------- Strain: BB1 Species: Caenorhabditis elegans Genotype: dcr-1(ok247)/unc-32(e189) III. Description: Heterozygotes are WT and segregate WT heterozygote, Uncs (unc-32 homozygotes), and Steriles (dcr-1 homozygotes). Mutagen: EMS Outcrossed: x8 Made by: B. Barstead Received: 01/30/02 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB19 Species: Caenorhabditis elegans Genotype: adr-1(tm668) I. Description: Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60. Mutagen: TMP/UV Outcrossed: x8 Made by: Mitani / Bass Received: 03/01/12 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB2 Species: Caenorhabditis elegans Genotype: adr-1(gv6) I. Description: Defective chemotaxis to volatile odorant. Low percentage (about 6%) have protruding vulva. Mutagen: EMS Outcrossed: x8 Made by: Michael Krause Received: 02/05/03 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB21 Species: Caenorhabditis elegans Genotype: adr-1(tm668) I; adr-2(ok735) III. Description: Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60. Mutagen: EMS Outcrossed: x8 Made by: Brenda Bass Received: 03/01/12 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB22 Species: Caenorhabditis elegans Genotype: adr-2(gv42) rde-4(ne299) III. Description: RNAi deficient. Maintain under normal conditions. Mutagen: EMS Outcrossed: x8 Made by: Brenda Bass Received: 03/01/12 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB23 Species: Caenorhabditis elegans Genotype: adr-1(gv6) I; adr-2(gv42) III; rde-1(ne219) V. Description: RNAi deficient. Maintain under normal conditions. Reference: Tonkin LA & BassBL. Science. 2003 Dec 5;302(5651):1725. Knight SW & Bass BL. Mol Cell. 2002 Oct;10(4):809-17. Mutagen: EMS Outcrossed: x8 Made by: Brenda Bass Received: 03/01/12 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB239 Species: Caenorhabditis elegans Genotype: adr-1(uu49) I; adr-2(uu28) III. Description: Chemotaxis deficient. Transgenes are silenced in this background. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. NOTE: In the referenced publication, irregularities were noted in the adr-1(gv6);adr-2(gv42) null strain, which were ascribed to background mutationsint hat strain. This strain -- adr-1(uu49);adr-2(uu28) -- was generated Crispr/Cas9 targeted mutation and phenotypes are more consistent with another null strain, adr-1(tm668);adr-2(ok735). Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Daniel Reich Received: 03/26/18 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB24 Species: Caenorhabditis elegans Genotype: adr-1(gv6) I; adr-2(gv42) rde-4(ne299) III. Description: RNAi deficient. Maintain under normal conditions. Reference: Tonkin LA & BassBL. Science. 2003 Dec 5;302(5651):1725. Mutagen: EMS Outcrossed: x8 Made by: Brenda Bass Received: 03/01/12 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB242 Species: Caenorhabditis elegans Genotype: adr-1(uu49) I; adr-2(uu28) III; rde-1(uu51) V. Description: RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Daniel Reich Received: 03/26/18 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB244 Species: Caenorhabditis elegans Genotype: adr-1(uu49) I; adr-2(uu28) rde-4(uu53) III. Description: RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Daniel Reich Received: 03/26/18 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB259 Species: Caenorhabditis elegans Genotype: adr-1(uu49) I; adr-2(uu28) III; ggIs1 IV. Description: ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. Mutagen: Outcrossed: x0 Made by: Daniel Reich Received: 03/26/18 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB261 Species: Caenorhabditis elegans Genotype: adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III. Description: Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Daniel Reich Received: 03/26/18 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB270 Species: Caenorhabditis elegans Genotype: adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; rde-1(uu51) V. Description: RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Daniel Reich Received: 03/26/18 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB272 Species: Caenorhabditis elegans Genotype: adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) rde-4(uu53) III. Description: RNAi deficient. Lacks RNA editing. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Daniel Reich Received: 03/26/18 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB278 Species: Caenorhabditis elegans Genotype: adr-1(uu49) I; rrf-3(uu56) II; adr-2(uu28) III; ggIs1 IV. Description: ggIs1 [nrde-3p::3xFlag::GFP::nrde-3 ORF + unc-119(+)] IV. Nuclear GFP::NRDE-3 signal. Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. Mutagen: Outcrossed: x0 Made by: Daniel Reich Received: 03/26/18 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB283 Species: Caenorhabditis elegans Genotype: adr-1(uu49) I; adr-2(uu28) III; ergo-1(uu68) V. Description: Enhanced RNAi. Lacks RNA editing. Vulval bursting. Low brood size. Triple mutants display bursting and low brood size phenotypes not observed in adr-1;adr-2 or rrf-3 parental strains. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. Mutagen: Crispr/Cas9 Outcrossed: x0 Made by: Daniel Reich Received: 03/26/18 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB3 Species: Caenorhabditis elegans Genotype: adr-2(gv42) III. Description: Defective chemotaxis to volatile odorant. Mutagen: EMS Outcrossed: x8 Made by: Michael Krause Received: 02/05/03 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB4 Species: Caenorhabditis elegans Genotype: adr-1(gv6) I; adr-2(gv42) III. Description: Defective chemotaxis to volatile odorant. Low percentage (about 6%) have protruding vulva. Mutagen: Outcrossed: x Made by: Michael Krause Received: 02/05/03 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB92 Species: Caenorhabditis elegans Genotype: dcr-1(ok247) III; uuEx18. Description: uuEx18 [dcr-1(wild-type) + dpy-30::mCherry]. Superficially wild-type. Reference: Welker N, et al. (2010) RNA 16:893-903. Mutagen: Outcrossed: x3 Made by: Noah Welker Received: 10/20/10 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB93 Species: Caenorhabditis elegans Genotype: dcr-1(ok247) III; uuEx19. Description: uuEx19 [dcr-1(K39A) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903. Mutagen: Outcrossed: x3 Made by: Noah Welker Received: 10/20/10 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB94 Species: Caenorhabditis elegans Genotype: dcr-1(ok247) III; uuEx20. Description: uuEx20 [dcr-1(D145N) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903. Mutagen: Outcrossed: x3 Made by: Noah Welker Received: 10/20/10 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BB95 Species: Caenorhabditis elegans Genotype: dcr-1(ok247) III; uuEx21. Description: uuEx21 [dcr-1(G492R) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903. Mutagen: Outcrossed: x3 Made by: Noah Welker Received: 10/20/10 University of Utah, Salt Lake City, UT ----------------------------------------------------------------------------- Strain: BC10002 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10002. Description: sEx10002[rCesC05D10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/30/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10004 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10004. Description: sEx10004 [rCes C54H2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 07/29/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10008 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10008. Description: sEx10008 [rCesF18E2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 01/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10010 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx841. Description: sEx841[rCesF43E2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 10/30/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10011 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx842. Description: sEx842 [rCesC34G6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 02/19/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10013 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx844. Description: sEx844 [rCesF22E10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10016 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx850. Description: sEx850 [rCesT21E8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10019 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx853. Description: sEx853 [rCes W09D6.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10021 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx855. Description: sEx855 [rCesC47A10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10023 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx857. Description: sEx857 [rCesDH11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 10/30/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10024 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx858. Description: sEx858 [rCesZK484.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 10/30/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10027 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx861. Description: sEx861 [rCes Y50E8A.16::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 12/08/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10028 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx862. Description: sEx862[rCesC54D1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 01/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10030 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx864. Description: sEx864 [rCesC05A9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10031 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx865. Description: sEx865 [rCesY43F8C.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 02/06/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10034 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx868. Description: sEx868 [rCesT21E8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/24/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10036 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx870. Description: sEx870 [rCes W04C9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10038 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx872. Description: sEx872[rCesF21G4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 01/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10042 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10042. Description: sEx10042 [rCes Y53C10A.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10048 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10048. Description: sEx10048 [rCes B0222.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10051 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10051. Description: sEx10051 [rCes F33H2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 07/13/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10058 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10058. Description: sEx10058 [rCes C56E6.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10059 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10059. Description: sEx10059 [rCes Y71F9AL.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10060 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx884. Description: sEx884 [rCesC12C8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Reza Pourvali Received: 02/17/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10062 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx890. Description: sEx890 [rCesF11F1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Reza Pourvali Received: 01/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10064 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx895. Description: sEx895 [rCesC37H5.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Received: 02/17/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10066 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx900. Description: sEx900 [rCesC15H9.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Reza Pourvali Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10068 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx893. Description: sEx893[rCesF54C9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Reza Pourvali Received: 03/24/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10074 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10074. Description: sEx10074 [rCesK04H4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10075 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10075. Description: sEx10075 [rCesY53C12C.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 05/29/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10077 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10077. Description: sEx10077 [rCesF56C9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10089 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10089. Description: sEx10089 [rCesF22E10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10095 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10095. Description: sEx10095 [rCesF11C3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/25/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10100 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10100. Description: sEx10100 [rCes C26E6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10101 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10101. Description: sEx10101 [rCesF37A4.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10102 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10102. Description: sEx10102 [rCes F01G4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 12/08/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10103 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10103. Description: sEx10103 [rCesF52B10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/03/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10105 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10105. Description: sEx10105 [rCesZk470.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/11/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10113 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10113. Description: sEx10113 [rCesF46B6.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 07/11/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10116 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10116. Description: sEx10116 [rCesF56B6.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10117 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10117. Description: sEx10117 [rCes Y119C1B.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/10/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10124 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10124. Description: sEx10124 [rCes F56B3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10128 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10128. Description: sEx10128 [rCes ZC395.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10131 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10131. Description: sEx10131 contains [rCes DH11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/23/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10133 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10133. Description: sEx10133 [rCes F38A5.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10141 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10141. Description: sEx10141 [rCesY54G2A.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 12/21/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10142 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10142. Description: sEx10142 [rCes Y54G2A.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/25/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10143 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10143. Description: sEx10143 [rCesF16D3.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/17/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10144 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10144. Description: sEx10144 [rCesC05C8.6:GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 07/01/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10146 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10146. Description: sEx10146 [rCesF58G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/18/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10148 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10148. Description: sEx10148 [rCesC30C11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10150 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10150. Description: sEx10150 [rCes K06A5.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10152 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10152. Description: sEx10152 [rCes PAR2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10154 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10154. Description: sEx10154 [rCes T05B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10157 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10157. Description: sEx10157 [rCesB0303.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10159 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10159. Description: sEx10159 [rCes B0280.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10160 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10160. Description: sEx10160 [rCesC17H12.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 09/19/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10162 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10162. Description: sEx10162[rCesB0511.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10163 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10163. Description: sEx10163 [rCes C28H8.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10170 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10170. Description: sEx10170 [rCes R06B10.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10173 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10173. Description: sEx10173 [rCes C17G10.9a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10175 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10175. Description: sEx10175 [rCes Y6D11A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10178 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10178. Description: sEx10178 [rCesC55B6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10180 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10180. Description: sEx10180 [rCes Y94H6A.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10182 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10182. Description: sEx10182 [rCes R13A5.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10183 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10183. Description: sEx10183 [rCes B0252.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10185 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10185. Description: sEx10185 [rCesC09B7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10190 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10190. Description: sEx10190 [rCesC30F8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/18/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10191 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10191. Description: sEx10191[rCesY65B4BL.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10197 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10197. Description: sEx10197 [rCes C01F6.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10200 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10200. Description: sEx10200 [rCes F48E8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/25/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10204 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10204. Description: sEx10204 [rCes C32F10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10206 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10206. Description: sEx10206 [rCesF59C12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/23/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10210 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10089. Description: sIs10089 [rCes F22E10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10214 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10214. Description: sEx10214 [rCes ZK1248.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10220 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10220. Description: sEx10220 [rCes C11D2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10222 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10222. Description: sEx10222 [rCes C09D4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10225 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10225. Description: sEx10225 [rCes C17E4.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10228 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10228. Description: sEx10228 [rCes F20D12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10230 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10230. Description: sEx10230 [rCes F53E2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10231 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10231. Description: sEx10231 [rCes F53E2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10232 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10232. Description: sEx10232 [rCes C27C12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10234 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10234. Description: sEx10234 [rCes C43G2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 09/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10241 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10241. Description: sEx10241 [rCes C49H3.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10243 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10243. Description: sEx10243 [rCes W01A11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10244 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10244. Description: sEx10244 [rCesM01E11.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10249 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10249. Description: sEx10249 [rCesK06H7.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/13/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10253 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10253. Description: sEx10253[rCesB0228.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10255 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10255. Description: sEx10255 [rCesC23G10.4b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/22/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10257 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10257. Description: sEx10257 [rCesZK455.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 09/19/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10261 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10261. Description: sEx10261 [rCes F42G2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10267 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10267. Description: sEx10267 [rCes F45E12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10273 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10273. Description: sEx10273 [rCes Y37D8A.22::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10276 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10276. Description: sEx10276 [rCes Y45F10A.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10278 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10278. Description: sEx10278 [rCesF52C12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10280 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10280. Description: sEx10280 [rCes K11C4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10281 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10281. Description: sEx10281 [rCesF52E1.13::GFP + pCeh361] Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/15/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10285 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10285. Description: sEx10285 [rCesZK795.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 03/11/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10287 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10287. Description: sEx10287 [rCes D2089.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10293 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10293. Description: sEx10293[rCesC47E8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 02/17/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10295 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10295. Description: sEx10295 [rCes ZC328.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10297 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10297. Description: sEx10297 [rCesM03F8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10304 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10304. Description: sEx10304 [rCes R07E3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10306 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10306. Description: sEx10306 [rCes PAR2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10307 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10307. Description: sEx10307 [rCes Y87G2A.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10312 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10312. Description: sEx10312[rCesC05D11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10316 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10316. Description: sEx10316 [rCes Y87G2A.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10320 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10320. Description: sEx10320 [rCes B0024.14a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10322 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10322. Description: sEx10322 [rCes K08E4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10326 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10326. Description: sEx10326 [rCes F32D1.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 07/13/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10331 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10331. Description: sEx10331[rCesB0034.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10336 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10336. Description: sEx10336 [rCes B0035.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10338 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10109. Description: sIs10109 [rCesY32H12A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Bob Johnsen Received: 03/02/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10340 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10340. Description: sEx10340 [rCesR07G3.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10342 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10342. Description: sEx10342 [rCes T06E8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10346 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10346. Description: sEx10346 [rCes B0228.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10350 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10350. Description: sEx10350 [rCesB0218.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10352 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10352. Description: sEx10352 [rCesB0035.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 01/27/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10364 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10364. Description: sEx10364 [rCesC44B7.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/30/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10366 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10366. Description: sEx10366 [rCes T02D1.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 02/01/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10368 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10368. Description: sEx10368 [rCes B0280.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10371 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10371. Description: sEx10371 [rCes C53B4.7a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10374 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10374. Description: sEx10374 [rCesB0511.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 01/24/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10375 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10375. Description: sEx10375 [rCes F22B7.::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10376 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10376. Description: sEx10376 [rCesZK688.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Victor Jensen Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10378 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10378. Description: sEx10378 [rCes C05C10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10379 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10379. Description: sEx10379 [rCesC16A3.10a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/20/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10385 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10385. Description: sEx10385 [rCes ZK632.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10394 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10394. Description: sEx10394 [rCes B0336.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10396 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10396. Description: sEx10396 [rCes C06E7.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10398 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10398. Description: sEx10398 [rCesC06A8.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10399 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10399. Description: sEx10399 [rCes C05B10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10400 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10400. Description: sEx10400 [rCesR155.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 10/27/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10407 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10407. Description: sEx10407 [rCes B0412.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/22/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10409 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10409. Description: sEx10409 [rCes B0414.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10416 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10416. Description: sEx10416 contains [rCesB0395.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10417 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10417. Description: sEx10417 [rCes B0361.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10421 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10421. Description: sEx10421[rCesC09G4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10425 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10425. Description: sEx10425 [rCes C09H6.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10427 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10427. Description: sEx10427 [rCesC09F5.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/24/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10431 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10431. Description: sEx10431[rCesB0496.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10433 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10433. Description: sEx10433[rCesT21B10.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 12/16/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10434 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10434. Description: sEx10434 [rCes Y46G5A.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10435 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10435. Description: sEx10435 [rCesC02F4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/02/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10442 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10442. Description: sEx10442 [rCes C01G8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10449 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10449. Description: sEx10449 [rCesB0547.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/13/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10453 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10092. Description: sIs10092[rCesY25C1A.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC10460 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10460. Description: sEx10460 [rCesC13C4.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/18/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10464 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10464. Description: sEx10464 [rCes ZK858.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10466 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10466. Description: sEx10466 [rCesC15H9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/06/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10468 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10468. Description: sEx10468 [rCes C15C7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10471 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10471. Description: sEx10471 [rCes F40F9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10475 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10475. Description: sEx10475 [rCesC24A11.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/17/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10477 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10477. Description: sEx10477 [rCesT10E9.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Victor Jensen Received: 02/12/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10482 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10482. Description: sEx10482[rCesY6B3B.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/10/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10484 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10484. Description: sEx10484 [rCesC18D11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 10/27/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10486 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10486. Description: sEx10486 [rCesZK721.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 07/02/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10489 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10489. Description: sEx10489 [rCesF36F2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/20/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10495 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10495. Description: sEx10495 [rCesT22B11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10505 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10505. Description: sEx10505 [rCes ZK792.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10506 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10506. Description: sEx10506 [rCes Y111B2A.18::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10508 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10508. Description: sEx10508 [rCes T04G9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10509 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10509. Description: sEx10509 [rCes W02C12.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10514 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10514. Description: sEx10514 [rCesT05E11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/17/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10516 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10516. Description: sEx10516 [rCesC47E12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 12/15/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10518 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10518. Description: sEx10518 [rCes Y17G7B.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10520 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10520. Description: sEx10520 [rCes F08F1.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10525 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10525. Description: sEx10525 [rCesZC404.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/04/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10537 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10537. Description: sEx10537 [rCesF10G7.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 02/20/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10538 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10538. Description: sEx10538 [rCes C36B1.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10543 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10543. Description: sEx10543[rCesR11A5.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/30/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10545 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10545. Description: sEx10545 [rCesF59A6.::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10549 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10549. Description: sEx10549 [rCes F20H11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10550 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10550. Description: sEx10550 [rCes C05D11.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10551 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10551. Description: sEx10551 [rCesF20H11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/19/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10553 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10553. Description: sEx10553 [rCes C05D11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10560 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10560. Description: sEx10560 [rCesY50D7A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10561 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10561. Description: sEx10561 contains [rCes F56H1.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10565 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10565. Description: sEx10565 [rCesY55F3BR.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10568 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10568. Description: sEx10568 [rCes C30F8.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10571 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10571. Description: sEx10571 [rCesT26A5.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/14/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10573 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10573. Description: sEx10573[rCesT26A5.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10574 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10574. Description: sEx10574 [rCesT26A5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10577 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10577. Description: sEx10577 [rCesF14F3.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 05/11/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10579 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10136. Description: sIs10136 [rCes C41D11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10588 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10126. Description: sIs10126 [rCes Y47G6A.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10589 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10109. Description: sIs10109 [rCesY32H12A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 03/02/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10594 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10594. Description: sEx10594 [rCesF35G12.3B::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10600 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10600. Description: sEx10600 [rCes C05D11.11a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10604 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10325. Description: sIs10325 [rCesC36A4.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Victor Jensen Received: 05/22/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10607 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10607. Description: sEx10607 [rCesF12F6.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 02/07/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10611 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10611. Description: sEx10611 [rCes F20D12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10612 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10612. Description: sEx10612 [rCes Y75B8A.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10614 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10614. Description: sEx10614 [rCes T25F10.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10615 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10615. Description: sEx10615 contains [rCesT01C8.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10618 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10618. Description: sEx10618 contains [rCesT05C12.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 12/01/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10621 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10621. Description: sEx10621[rCesF54G8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/28/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10623 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10623. Description: sEx10623 [rCesF54A5.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10629 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10629. Description: sEx10629 [rCesY39A1A.15b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10634 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10634. Description: sEx10634 [rCes Y39G10AR.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10640 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10640. Description: sEx10640 [rCesY47H9C.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 05/28/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10642 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10642. Description: sEx10642[rCesC29E6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/06/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10650 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10247. Description: sIs10247 [rCes ZC13.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10652 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10253. Description: sIs10253 [rCesB0228.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: J Lin & L Halim Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10653 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10259. Description: sIs10259 [rCesY32H12A.8::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC10655 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10655. Description: sEx10655 [rCes B0336.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 01/25/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10656 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10656. Description: sEx10656 [rCes K08D12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 01/27/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10660 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10660. Description: sEx10660 [rCesF15C11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/01/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10661 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10661. Description: sEx10661[rCesY48C3A.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10665 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10665. Description: sEx10665 [rCes Y48B6A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10671 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10137. Description: sIs10137 [rCesM03F4.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 12/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10672 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10263. Description: sIs10263[rCesF35H8.6::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC10674 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10107. Description: sIs10107 [rCes F32A6.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10675 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10135. Description: sIs10135 [rCesZK177.8a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakkan Received: 10/20/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10680 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10083. Description: sIs10083[rCesF55A12.8::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC10688 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10688. Description: sEx10688 [rCes Y116A8A.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10689 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10689. Description: sEx10689 [rCesY25C1A.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10691 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10691. Description: sEx10691[rCesY54E5A.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/11/24 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10697 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10697. Description: sEx10697 [rCesZC101.2e::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 03/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10699 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10699. Description: sEx10699 [rCes ZK154.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC107 Species: Caenorhabditis elegans Genotype: bli-4(e937) dpy-14(e188) I. Description: Blistered. Dpy (ts). Mutagen: Outcrossed: x Made by: Ann Rose Received: 10/06/99 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10700 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10700. Description: sEx10700 [rCesZK632.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 03/11/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10709 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10112. Description: sIs10112 [rCes Y69A2AR.18::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 10/04/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10711 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10218. Description: sIs10218 [rCes C13F10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10713 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10193. Description: sIs10193[rCesZK822.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 06/18/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10715 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10236. Description: sIs10236 [rCes Y32H12A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10716 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10236. Description: sIs10236 [rCesY32H12A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 09/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10717 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10503. Description: sIs10503 [rCesY71H2B.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Robert Johnsen Received: 06/20/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10718 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10246. Description: sIs10246 [rCesF10E9.6b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 01/11/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10719 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10576. Description: sIs10576 contains [rCes F11D5.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Robert Johnson Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10720 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10523. Description: sIs10523[rCesC18H9.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Johnsen Received: 02/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10721 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10524. Description: sIs10524 [rCes C17H12.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10723 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10723. Description: sEx10723 [rCes C24A1.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10732 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10623. Description: sIs10623[rCesF54A5.3a::GFP + pCeh361]. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: Victor Jensen Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10733 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10623. Description: sEx10623[rCesF54A5.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC10734 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10734. Description: sEx10734 [rCes T16G1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10744 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10744. Description: sEx10744 [rCesC48A7.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10749 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10749. Description: sEx10749 [rCes F08B12.3b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/07/13 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10751 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10751. Description: sEx10751[rCesC44B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 06/19/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10753 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10753. Description: sEx10753 [rCes Y57G11C.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10754 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10754. Description: sEx10754 [rCes C09G12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 01/27/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10760 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10760. Description: sEx10760 [rCesY54F10AM.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10766 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10766. Description: sEx10766 [rCes F20D12.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10770 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10239. Description: sIs10239 [rCes C28H8.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10773 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10773. Description: sEx10773 [rCes B0250.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10784 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10784. Description: sEx10784 contains [rCes C07H4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 08/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10785 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10785. Description: sEx10785 contains [rCes Y108G3AL.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: L. Fang/Z. Zhao Received: 10/21/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10787 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10787. Description: sEx10787 [rCes Y18D10A.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10792 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10792. Description: sEx10792[rCesY55F3AL.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: L Fang & Z Zhao Received: 04/18/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10795 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10795. Description: sEx10795 [rCesY39B6A.20::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: L Fang & Z Zhao Received: 02/17/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10796 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10796. Description: sEx10796 [rCes ZC395.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/08/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10804 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10804. Description: sEx10804 [rCes Y67H2A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10809 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10564. Description: sIs10564 contains [rCes T26C12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10812 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10602. Description: sIs10602 contains [rCes K07A9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 08/29/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10814 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10814. Description: sIs10814 [rCesT06H11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-ray Outcrossed: x Made by: Robert Hollebakken Received: 10/27/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10818 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10693. Description: sIs10693[rCesY54E2A.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 11/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10819 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10697. Description: sIs10697 [rCesZC101.2e::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). sIs10697 [rCesZC101.2e::GFP + pCeh361] Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 03/02/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10825 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10825. Description: sEx10825 [rCes D2030.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10829 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10829. Description: sEx10829 [rCesF16B3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10830 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10830. Description: sEx10830 [rCes C26C6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/13/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10836 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10836. Description: sEx10836 [rCesT28F2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 11/14/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10837 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10837. Description: sEx10837 [rCesB0334.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 09/12/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10838 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10838. Description: sEx10838 [rCes C05C8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10848 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10703. Description: sIs10703[rCesR09F10.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 07/24/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10849 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10707. Description: sIs10707 [rCes F28H7.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10853 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10623. Description: sIs10623 [rCesF54A5.3A::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Victor Jensen Received: 08/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10856 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10123. Description: sIs10123[rCesT10H9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Victor Jensen Received: 02/02/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10860 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10860. Description: sEx10860 [rCes M01F1.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10862 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10862. Description: sEx10862 [rCes T04A8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 12/01/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10873 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10873. Description: sEx10873 [rCes ZC506.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10874 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10874. Description: sEx10874 [rCesC01G8.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10891 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10891. Description: sEx10891 [rCes C16C10.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10902 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10902. Description: sEx10902 [rCes C18E9.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10909 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10909. Description: sEx10909 [rCes W01A11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10910 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10910. Description: sEx10910 [rCesT20F10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10912 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10912. Description: sEx10912[rCesT07C4.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 01/03/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10917 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10917. Description: sEx10917 [rCes Y43B11AR.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10929 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10929. Description: sEx10929 [rCes C27H5.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/14/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10933 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10933. Description: sEx10933 [rCesF34H10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10950 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10950. Description: sEx10950 [rCesF38H4.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10952 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10952. Description: sEx10952[rCesR09B5.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10981 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10981. Description: sEx10981 [rCes Y71G12B.16::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC10999 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx10999. Description: sEx10999 [rCes D1054.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC110 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-85(s142)/unc-15(e73) I. Description: Heterozygotes are WT and segregate WT, Unc and DpyUncLets. Lethal at L1. Maintain by picking WT. Mutagen: EMS Outcrossed: x Made by: Ann Rose Received: 01/26/93 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC11000 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11000. Description: sEx11000 [rCes ZC412.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11002 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11002. Description: sEx11002 [rCes C56C10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/25/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11003 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11003. Description: sEx11003[rCesD2030.9a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11009 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11009. Description: sEx11009 [rCesZK970.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: AllanMah Received: 11/05/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11010 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11010. Description: sEx11010 [rCesZK792.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/18/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11018 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11018. Description: sEx11018 [rCes C38C10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11019 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11019. Description: sEx11019 [rCesC44B12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11021 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11021. Description: sEx11021 [rCes F28F8.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11024 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11024. Description: sEx11024 [rCes F28D1.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11025 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11025. Description: sEx11025 [rCes F27D4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11026 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11026. Description: sEx11026 [rCesF27C1.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11027 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11027. Description: sEx11027 [rCesF26D10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/15/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11040 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11040. Description: sEx11040 [rCes F22D6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/19/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11042 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11042. Description: sEx11042 [rCes F13E6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11043 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11043. Description: sEx11043 [rCesF14D12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11044 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11044. Description: sEx11044 [rCesF10B5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11048 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11048. Description: sEx11048 [rCes F11A10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11054 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11054. Description: sEx11054 [rCesF31C3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/15/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11057 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11057. Description: sEx11057 [rCes F31D4.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11059 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11059. Description: sEx11059 [rCesF38A6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/25/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11061 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11061. Description: sEx11061 [rCes F39B2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11062 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11062. Description: sEx11062[rCesF37C12.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/11/24 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11063 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11063. Description: sEx11063 [rCes F38A5.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11065 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11065. Description: sEx11065 [rCesF42D1.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/02/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11068 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11068. Description: sEx11068 [rCesF46A9.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/07/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11070 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11070. Description: sEx11070 [rCes C44E4.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11072 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11072. Description: sEx11072[rCesC46F11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11078 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11078. Description: sEx11078 [rCes C02B10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11085 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11085. Description: sEx11085 [rCesF46E10.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/21/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11090 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11090. Description: sEx11090 [rCes ZK512.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11098 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11098. Description: sEx11098 [rCes Y62E10A.13c::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11100 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11100. Description: sEx11100 [rCes C18C4.10b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11102 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11102. Description: sEx11102 [rCes R02F2.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11105 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11105. Description: sEx11105 [rCes C37E2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11106 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11106. Description: sEx11106 [rCes Y50D7A.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11108 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11108. Description: sEx11108 [rCes C28H8.11b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11109 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11109. Description: sEx11109 [rCes B0416.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11110 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11110. Description: sEx11110 [rCesT04C12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/03/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11111 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11111. Description: sEx11111[rCesC32F10.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11116 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11116. Description: sEx11116 [rCesT10H9.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/24/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11120 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11120. Description: sEx11120 [rCesF53A3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/08/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11124 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11124. Description: sEx11124 [rCesF47D12.4b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 05/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11128 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11128. Description: sEx11128 [rCesK10B3.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 02/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11129 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11129. Description: sEx11129 [rCesF41E7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 10/27/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11137 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11137. Description: sEx11137 [rCesF43H9.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11139 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11139. Description: sEx11139 [rCes R11E3.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11142 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11142. Description: sEx11142[rCesY48D7A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/07/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11150 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11150. Description: sEx11150 [rCesF38B7.1B::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11161 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11161. Description: sEx11161 [rCesH21P03.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/18/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11164 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11164. Description: sEx11164 [rCes K02F2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11168 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11168. Description: sEx11168 [rCesZK1127.9b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11172 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11172. Description: sEx11172 [rCes C33H5.18b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11178 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11178. Description: sEx11178 [rCes R166.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11180 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11180. Description: sEx11180 [rCes C10G8.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/27/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11182 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11182. Description: sEx11182[rCesZK381.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11183 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11183. Description: sEx11183[rCesZK381.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/14/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11186 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11186. Description: sEx11186 [rCesC54D1.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/18/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11190 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11190. Description: sEx11190 [rCes C44C1.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11193 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11193. Description: sEx11193 [rCes C50D2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11195 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11195. Description: sEx11195 [rCesC39F7.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11198 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11198. Description: sEx11198 [rCesT23B12.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC112 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-82(s85)/unc-15(e73) I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc, and DpyUncLet (DpyUnc Larvae are abnormal). Maintain by picking WT. Mutagen: EMS Outcrossed: x Made by: Ann Rose Received: 09/01/82 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC11201 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10158. Description: sIs10158 [rCesF54D8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: Robert Hollebakken Received: 10/24/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11202 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10158. Description: sIs10158 [rCes F54D8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11205 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10309. Description: sIs10309 [rCes F27D9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11206 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10309. Description: sIs10309 [rCes F27D9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11207 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10648. Description: sIs10648 [rCes Y45F3A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11215 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10171. Description: sIs10171 [rCes C30F12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11217 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10139. Description: sIs10139 [rCes F10E7.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11221 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11221. Description: sEx11221[rCesF28D1.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11234 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11234. Description: sEx11234 [rCes C02E11.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11238 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11238. Description: sEx11238 [rCesH39E23.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 01/04/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11239 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11239. Description: sEx11239 [rCesR11H6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 02/25/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11241 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11241. Description: sEx11241 [rCes T22D1.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11245 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11245. Description: sEx11245 [rCes Y55D9A.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11253 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11253. Description: sEx11253 [rCes T03F6.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11255 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11255. Description: sEx11255 [rCesF19B6.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/03/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11264 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11264. Description: sIs11264 [rCesK07A3.1::GFP + pCeh361]. Inserted array seems to be unstable or prone to silencing. Pick non-Dpy GFP+ animals to maintain array. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). [NOTE: Though this strain is reported as carrying an integrated array, this strain segregates both GFP+ non-Dpy and GFP- Dpy.] Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/19/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11267 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11267. Description: sEx11267 [rCesK10G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/24/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11269 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11269. Description: sEx11269 [rCesR05F9.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/20/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11271 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11271. Description: sEx11271 [rCes R01H10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/13/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11274 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11274. Description: sEx11274 [rCesM163.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11281 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11281. Description: sEx11281 [rCes R07H5.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11286 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11286. Description: sEx11286 [rCesK07H8.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/04/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11288 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11288. Description: sEx11288 [rCes W02C12.3b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/24/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11290 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11290. Description: sEx11290 [rCesC04F6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 12/13/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11293 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11293. Description: sEx11293 [rCes Y71H10B.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11301 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11301. Description: sEx11301[rCesR13A5.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11304 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11304. Description: sEx11304 [rCesR09E12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/16/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11306 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11306. Description: sEx11306 [rCesT03E6.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/20/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11307 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11307. Description: sEx11307 [rCes T05A7.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11309 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11309. Description: sEx11309 [rCes T22C1.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11314 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11314. Description: sEx11314 [rCesT20G5.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/15/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11317 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11317. Description: sEx11317 [rCes T22H6.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11318 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11318. Description: sEx11318 [rCes T21B10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11319 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11319. Description: sEx11319 [rCes T21D12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11321 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11321. Description: sEx11321 [rCes T23G5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11322 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11322. Description: sEx11322 [rCes T25G12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11324 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11324. Description: sEx11324 [rCesT23G5.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 07/06/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11334 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11334. Description: sEx11334 [rCes W09C5.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11336 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11336. Description: sEx11336 [rCesT10B11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11338 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11338. Description: sEx11338 [rCes Y54E10A.9a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/05/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11353 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10295. Description: sIs10295 [rCesZC328.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11356 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10402. Description: sIs10402 contains [rCes C08B6.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Robert Hollebakken Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11358 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10334. Description: sIs10334 [rCesC13B9.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 02/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11360 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10905. Description: sIs10905 [rCesT27E9.4a::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC11361 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10905. Description: sIs10905 [rCes T27E9.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11364 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10402. Description: sIs10402[rCesC08B6.8::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC11365 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10402. Description: sIs10402 [rCes C08B6.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11367 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10403. Description: sIs10403[rCesF32F2.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC11369 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11369. Description: sEx11369 [rCesT03G6.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11374 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11374. Description: sEx11374 [rCes F53A9.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/19/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11393 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11393. Description: sEx11393 [rCes F26H9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11395 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11395. Description: sEx11395 [rCesT19E7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11397 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11397. Description: sEx11397 [rCes C01B7.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11408 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11408. Description: sEx11408 [rCes B0414.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11409 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11409. Description: sEx11409 [rCesF10B5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11410 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11410. Description: sEx11410 [rCes M04B2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/19/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11412 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11412. Description: sEx11412 [rCesY51H4A.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11413 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11413. Description: sEx11413 [rCes Y76B12C.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11416 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11416. Description: sEx11416 [rCesR07B7.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11417 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11417. Description: sEx11417 [rCesK11E8.1d::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 01/18/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11418 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11418. Description: sEx11418 [rCes F33C8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11419 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11419. Description: sEx11419 [rCesK03F8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11420 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11420. Description: sEx11420 [rCes C09C7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11424 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11424. Description: sEx11424 [rCes E02H4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11425 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11425. Description: sEx11425 contains [rCes Y39E4B.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 08/26/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11430 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11430. Description: sEx11430 [rCesF22E10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/03/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11436 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11436. Description: sEx11436 [rCesC33A11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/10/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11438 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11438. Description: sEx11438 [rCesC05E4.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11439 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11439. Description: sEx11439 [rCesC36E8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/02/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11445 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10122. Description: sIs10122 [rCes K02A4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11450 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11450. Description: sEx11450 [rCesK08C7.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11452 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11452. Description: sEx11452 [rCes R09A1.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11466 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11466. Description: sEx11466 [rCesF13B10.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 02/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11468 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11468. Description: sEx11468 [rCes F48C11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11472 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11472. Description: sEx11472 [rCes C55H1.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 12/28/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11473 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11473. Description: sEx11473[rCesT23H2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 04/11/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11475 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11475. Description: sEx11475 [rCesF56D12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 04/18/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11477 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11477. Description: sEx11477 [rCes F55D10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11480 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11480. Description: sEx11480 [rCes F55C7.7b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11487 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11487. Description: sEx11487 [rCesZC53.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 09/25/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11493 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11493. Description: sEx11493[rCesZK1127.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 02/20/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11494 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11494. Description: sEx11494 [rCesF26E4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/08/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11495 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11495. Description: sEx11495 [rCes F33H2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11497 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11497. Description: sEx11497 [rCes F56H9.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/28/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC115 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-81(s88)/unc-15(e73) I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncLets are abnormal larvae and die in early larval development. Pick WT to maintain. Mutagen: EMS Outcrossed: x Made by: Ann Rose Received: 09/01/82 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC11504 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11504. Description: sEx11504 [rCesY8G1A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/11/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11507 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11507. Description: sEx11507 [rCes T21H3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11510 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10411. Description: sIs10411[rCes B0457.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 06/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11512 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10392. Description: sIs10392[rCesB0334.4::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC11513 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10779. Description: sIs10779 [rCes C04G6.3::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Bombardment Outcrossed: x0 Made by: Robert Hollebakken Received: 01/23/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11515 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10781. Description: sIs10781[rCesC10H11.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 04/16/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11518 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10379. Description: sIs10379 [rCesC16A3.10a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 02/20/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11520 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10358. Description: sIs10358 [rCesY102A11A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 02/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11521 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10354. Description: sIs10354 [rCesY39D8C.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC11522 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10354. Description: sIs10354 [rCesY39D8C.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC11525 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10330. Description: sIs10330 [rCesB0034.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 06/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11529 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11529. Description: sEx11529 [rCes F48G7.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11539 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11539. Description: sEx11539 [rCesF14D12.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/28/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11545 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11545. Description: sEx11545 [rCesK02F2.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/31/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11552 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11552. Description: sEx11552[rCesF54G8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/11/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11562 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11562. Description: sEx11562 [rCes Y32G9A.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11564 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11564. Description: sEx11564 [rCesC02A12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/06/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11566 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11566. Description: sEx11566 [rCesY19D10A.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/25/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11571 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11571. Description: sEx11571 contains [rCes F39G3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 12/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11580 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11580. Description: sEx11580 [rCes JC8.10b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11584 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11584. Description: sEx11584 [rCesK08E3.5b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 03/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11587 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10415. Description: sIs10415 [rCes B0395.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 11/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11588 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11330. Description: sIs11330 [rCesW02D3.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 02/06/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11598 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11598. Description: sEx11598 [rCesF58G4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 09/24/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11600 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11600. Description: sEx11600 [rCesE03G2.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11601 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11601. Description: sEx11601 [rCes M01A10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11603 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11603. Description: sEx11603[rCesT12A2.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/06/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11610 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11610. Description: sEx11610 [rCesZK287.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11611 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11611. Description: sEx11611 [rCes F40F9.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11613 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11613. Description: sEx11613[rCesM02B7.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11617 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11617. Description: sEx11617 [rCes W01A11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/15/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11620 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11620. Description: sEx11620 [rCes R13H4.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 02/06/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11626 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11626. Description: sEx11626 [rCes T13H5.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/25/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11630 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11630. Description: sEx11630 [rCesC07H6.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/31/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11631 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11631. Description: sEx11631[rCesY57E12AL.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/06/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11648 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11648. Description: sEx11648 [rCesC06C6.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/31/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11649 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11649. Description: sEx11649 [rCesF40F8.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11654 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11654. Description: sEx11654 [rCesW06H8.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11659 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11659. Description: sEx11659 [rCes M106.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11660 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11660. Description: sEx11660 [rCes F10D7.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11661 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11661. Description: sEx11661 [rCes Y73F8A.24::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11664 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11664. Description: sEx11664 [rCes C08F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11667 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11667. Description: sEx11667 [rCesW05E10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 02/20/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11669 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11669. Description: sEx11669 [rCes C25E10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11679 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11679. Description: sEx11679 [rCes C50F2.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11688 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11688. Description: sEx11688 [rCes F39H12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11694 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11694. Description: sEx11694 contains [rCes ZK856.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Zhongying Zhao Received: 10/21/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11696 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11696. Description: sEx11696 contains [rCes C04F6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Zhongying Zhao Received: 11/18/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11699 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11699. Description: sEx11699 [rCesY62F5A.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 01/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11701 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11701. Description: sEx11701 [rCes C01F1.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11706 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11706. Description: sEx11706 [rCesF36A2.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11709 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11709. Description: sEx11709 [rCesC27H5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 04/22/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11716 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11716. Description: sEx11716 [rCesZK637.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/18/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11729 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11729. Description: sEx11729 [rCes Y49E10.20::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11730 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11730. Description: sEx11730 [rCesF48E8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 01/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11735 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11735. Description: sEx11735 [rCesY82E9BR.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11736 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11736. Description: sEx11736 [rCes H28G03.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11742 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11742. Description: sEx11742[rCesT04C9.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11751 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11751. Description: sEx11751[rCesF53F10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/24/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11760 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11760. Description: sEx11760 [rCesF55A12.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 06/20/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11763 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11763. Description: sEx11763 [rCesK04F10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/24/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11770 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11770. Description: sEx11770 [rCes F49E12.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11772 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11772. Description: sEx11772 [rCes C49C8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11774 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11774. Description: sEx11774 [rCesB0035.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/31/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11776 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11776. Description: sEx11776 [rCes C10H11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11778 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11778. Description: sEx11778 [rCes F26E4.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11779 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11779. Description: sEx11779 [rCes K07E3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11780 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11780. Description: sEx11780 [rCesB0496.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/16/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11787 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11787. Description: sEx11787 [rCes C34G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11792 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11792. Description: sEx11792[rCesD2013.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 12/22/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11793 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11793. Description: sEx11793[rCesD2085.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11796 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11796. Description: sEx11796 [rCes F22F4.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11799 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11799. Description: sEx11799 [rCesF56E3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/24/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11803 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11803. Description: sEx11803 [rCesEEED8.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 07/10/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11808 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11808. Description: sEx11808 [rCes F38E9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11815 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11815. Description: sEx11815 [rCes Y52B11A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11817 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11817. Description: sEx11817 [rCes Y56A3A.19::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11822 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11822. Description: sEx11822 [rCes T12A2.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11824 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11824. Description: sEx11824 [rCesZK1098.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11825 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11825. Description: sEx11825 [rCes ZK1098.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11831 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11831. Description: sEx11831[rCesK11D2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11840 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10741. Description: sIs10741[rCesC50F2.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 10/20/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11841 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11122. Description: sIs11122 [rCes T22B2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11844 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11844. Description: sEx11844 [rCes F18F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11847 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11847. Description: sEx11847 [rCesW02D7.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/18/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11848 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11848. Description: sEx11848 [rCes Y24F12A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11849 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11849. Description: sEx11849 [rCes C30F12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11851 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11851. Description: sEx11851 [rCes C32E8.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11853 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11853. Description: sEx11853 [rCes ZC64.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11855 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11855. Description: sEx11855 [rCes C17G10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11856 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11856. Description: sEx11856 [rCesCD4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/24/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11857 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11857. Description: sEx11857 [rCes C15C7.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11858 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10428. Description: sIs10428 [rCes C10C6.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: John Lin/Leny Halim Received: 01/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11859 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11859. Description: sEx11859 [rCesC53D6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11862 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11862. Description: sEx11862[rCesF32B6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/31/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11864 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11864. Description: sEx11864 [rCes T13H10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11868 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11868. Description: sEx11868 [rCes T27A8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11871 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11871. Description: sEx11871 [rCes T01G1.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11875 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11875. Description: sEx11875 [rCesZC168.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11878 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11878. Description: sEx11878 [rCesC06G8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/02/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11883 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11883. Description: sEx11883 [rCes ZK792.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11886 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11886. Description: sEx11886 [rCesY47D3A.25::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 06/06/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11887 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11887. Description: sEx11887 [rCesY75B8A.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/18/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11893 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11893. Description: sEx11893 [rCes F20D6.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11894 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11894. Description: sEx11894 [rCes C15C8.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11897 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11897. Description: sEx11897 [rCesY47D3A.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11898 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11898. Description: sEx11898 [rCesF44D12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 03/02/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC119 Species: Caenorhabditis elegans Genotype: blmp-1(s71) I. Description: Dpy. Mutagen: EMS Outcrossed: x Made by: Rose A Received: 09/01/82 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11902 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11902. Description: sEx11902[rCesM18.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11904 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11904. Description: sEx11904 [rCesB0001.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/21/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11906 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11906. Description: sEx11906 [rCes F35G2.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11909 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11909. Description: sEx11909 [rCesK09E10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11911 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11911. Description: sEx11911 [rCes T04A11.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11922 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11922. Description: sEx11922 [rCes W02A2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11923 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11923. Description: sEx11923 [rCesY62E10A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11926 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10429. Description: sIs10429 [rCes C12D8.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 09/01/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11928 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10491. Description: sIs10491[rCesR12B2.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11936 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11936. Description: sEx11936 [rCes Y105C5B.21::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/02/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11937 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11937. Description: sEx11937 [rCesF54C8.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11938 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11938. Description: sEx11938 [rCesF54D5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11941 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11941. Description: sEx11941[rCesF23B12.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11945 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11945. Description: sEx11945 [rCesF43E2.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 02/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11946 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11946. Description: sEx11946 [rCes F30H5.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11948 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11948. Description: sEx11948 [rCesF08F3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/18/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11949 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11949. Description: sEx11949 [rCes C01H6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11958 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11958. Description: sEx11958 [rCes AH6.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11960 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11960. Description: sEx11960 [rCesC35D10.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/06/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11964 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11964. Description: sEx11964 [rCesY67D2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11970 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11970. Description: sEx11970 [rCesC37C3.6a::GFP + pCeh361] Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/31/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11973 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11973. Description: sEx11973 [rCes C50E10.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11976 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11976. Description: sEx11976 [rCes B0304.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11985 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11985. Description: sEx11985 [rCes F37C12.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11990 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11990. Description: sEx11990 [rCesY106G6E.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Zhongying Zhao Received: 01/24/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11995 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11995. Description: sEx11995 [rCesF59A2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC11999 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11999. Description: sEx11999 [rCes F57G9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12002 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12002. Description: sEx12002 [rCes Y39G8B.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12003 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12003. Description: sEx12003 [rCes F58A6.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12005 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12005. Description: sEx12005 [rCes T21H8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12008 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12008. Description: sEx12008 [rCes Y57A10B.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12009 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12009. Description: sEx12009 [rCes ZK265.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1201 Species: Caenorhabditis elegans Genotype: sDf19/nT1 IV; +/nT1 V. Description: sDf19 has a dominant twitcher phenotype, and is homozygous lethal-usually arresting as embryos, but occasionally will hatch. Heterozygotes are twitchers and segregate twitchers, Vulvaless and dead eggs (or lethal early larvae). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Outcrossed: x Made by: T. Rogalski Received: 10/01/84 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12012 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12012. Description: sEx12012 [rCes C47A10.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12016 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12016. Description: sEx12016 [rCes T20D4.18::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12017 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12017. Description: sEx12017 [rCesZK637.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12019 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12019. Description: sEx12019 [rCes F56G4.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12021 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12021. Description: sEx12021[rCesT12A2.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/18/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12028 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12028. Description: sEx12028 [rCesF57C12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 02/18/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12036 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12036. Description: sEx12036 [rCes F22E10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 12/08/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12037 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12037. Description: sEx12037 [rCes Y34D9A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12039 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12039. Description: sEx12039 contains [rCes ZK121.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 08/26/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12045 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12045. Description: sEx12045 [rCes T20D4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12047 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12047. Description: sEx12047 [rCes C33A12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12048 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12048. Description: sEx12048 [rCes H10D18.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12051 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12051. Description: sEx12051 [rCes Y47D3A.6b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12068 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12068. Description: sEx12068 [rCesK07B1.5b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12073 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12073. Description: sEx12073 [rCes B0041.7a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12075 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12075. Description: sEx12075 [rCesF12F6.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 01/24/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12078 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12078. Description: sEx12078 [rCes T08G11.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12079 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12079. Description: sEx12079 [rCes B0285.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12082 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12082. Description: sEx12082 [rCes F25F2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 08/25/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12095 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12095. Description: sEx12095 [rCes F28F5.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12098 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12098. Description: sEx12098 [rCes C05B5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12101 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12101. Description: sEx12101[rCesF42A9.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 12/17/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12103 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12103. Description: sEx12103 contains [rCes F42G10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Zhongying Zhao Received: 10/12/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12107 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12107. Description: sEx12107 [rCesC47C12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12110 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12110. Description: sEx12110 [rCesT07H3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12111 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12111. Description: sEx12111 [rCes C03G5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12113 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12113. Description: sEx12113[rCesW07A12.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12115 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12115. Description: sEx12115 [rCesC24G7.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Zhongying Zhao Received: 06/19/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12117 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12117. Description: sEx12117 [rCesF46F11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12120 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12120. Description: sEx12120 [rCesF08G2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/31/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12128 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12128. Description: sEx12128 [rCesY59C2A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12133 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12133. Description: sEx12133 [rCes C50E10.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12138 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12138. Description: sEx12138 [rCes F09E10.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12139 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12139. Description: sEx12139 [rCesY48A6A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 11/27/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12142 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12142. Description: sEx12142[rCesR03E9.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Zhongying Zhao Received: 10/28/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12145 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12145. Description: sEx12145 [rCes Y45G12C.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 02/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12146 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12146. Description: sEx12146 [rCesB0379.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 08/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12152 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12152. Description: sEx12152[rCesF20B6.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 09/05/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12154 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12154. Description: sEx12154 [rCes F52F12.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 01/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12158 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12158. Description: sEx12158 [rCes F09F7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12159 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12159. Description: sEx12159 [rCes C27F2.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1216 Species: Caenorhabditis elegans Genotype: sDf21 dpy-4/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Made by: Wild G Received: 01/14/92 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12162 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12162. Description: sEx12162[rCesH13N06.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1217 Species: Caenorhabditis elegans Genotype: sDf22/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Made by: G. Wild Received: 12/15/87 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12173 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12173. Description: sEx12173[rCesT21H8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/24/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12175 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12175. Description: sEx12175 [rCesC36C5.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/24/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12177 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12177. Description: sEx12177 [rCes C33G8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12181 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12181. Description: sEx12181[rCesM01H9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/03/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12182 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12182. Description: sEx12182 [rCes T20D4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12187 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12187. Description: sEx12187 [rCes Y53C10A.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12188 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12188. Description: sEx12188 [rCesC02B8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12190 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12190. Description: sEx12190 [rCesF11C3.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12191 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12191. Description: sEx12191[rCesT17E9.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 05/26/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12194 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12194. Description: sEx12194 [rCes Y39C12A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12195 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12195. Description: sEx12195 [rCes Y39C12A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12198 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12198. Description: sEx12198 [rCes T07H8.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12200 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12200. Description: sEx12200 [rCes F57G9.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12201 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12201. Description: sEx12201 [rCes R07B7.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12205 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12205. Description: sEx12205 [rCesC26F1.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 08/16/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12211 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12211. Description: sEx12211 [rCes C50E10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/25/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12212 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12212. Description: sEx12212 [rCes AH6.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12220 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12220. Description: sEx12220 [rCes C34H4.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12224 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12224. Description: sEx12224 [rCesC08A9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12225 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12225. Description: sEx12225 [rCesY47D3A.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12229 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12229. Description: sEx12229 [rCesY37B11A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12230 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12230. Description: sEx12230 [rCes F13G3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12231 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12231. Description: sEx12231[rCesE04F6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12233 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12233. Description: sEx12233[rCesC13G5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12234 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12234. Description: sEx12234 [rCesC13G5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 05/21/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12236 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12236. Description: sEx12236 [rCesY76A2B.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12239 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12239. Description: sEx12239 [rCesD1081.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12246 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12246. Description: sEx12246 [rCes F54F11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12251 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12251. Description: sEx12251 [rCes R144.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12268 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12268. Description: sEx12268 [rCesC35D10.16::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/03/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1227 Species: Caenorhabditis elegans Genotype: sDf23/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Made by: Dave Baillie Received: 01/05/93 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12270 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12270. Description: sEx12270 [rCesF46F3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12275 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12275. Description: sEx12275 [rCesM142.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12276 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10439. Description: sIs10439 [rCesC03C10.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 10/01/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12278 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10460. Description: sIs10460 [rCes C13C4.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 10/03/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12279 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10437. Description: sIs10437 [rCesC02E11.1a::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12285 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12285. Description: sEx12285 [rCes C27D6.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12286 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12286. Description: sEx12286 [rCes C27D6.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12299 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12299. Description: sEx12299 [rCes C50C3.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/29/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC123 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-84(s91)/unc-15(e73) I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncs are abnormal larvae that die in late larval development. Pick WT to maintain. Mutagen: EMS Outcrossed: x Made by: Ann Rose Received: 09/01/82 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC1230 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf27 unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Made by: R. Rosenbluth Received: 07/01/85 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12301 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10475. Description: sIs10475 [rCesC24A11.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 05/31/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12302 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10480. Description: sIs10480 [rCes T28F3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 09/19/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12303 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10441. Description: sIs10441 [rCes C03A3.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12304 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10289. Description: sIs10289 [rCesB0545.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12310 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12310. Description: sEx12310 [rCesR05G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12312 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12312. Description: sEx12312[rCesK12C11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12315 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12315. Description: sEx12315 [rCesK10B3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Emily Ha Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12319 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12319. Description: sEx12319 [rCes F13G3.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12326 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12326. Description: sEx12326 [rCes Y73F4A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12345 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12345. Description: sEx12345 [rCesC06E8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12350 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12119. Description: sIs12119 [rCesC53A3.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 03/23/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12351 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12121. Description: sIs12121 [rCes F43G9.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12352 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12144. Description: sIs12144 [rCesR08E3.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 02/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12357 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12078. Description: sIs12078 [rCes T08G11.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12358 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12098. Description: sIs12098 [rCesC05B5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 10/20/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12360 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12140. Description: sIs12140 [rCes M195.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12361 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12069. Description: sIs12069 [rCesR05F9.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 11/14/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12362 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12101. Description: sIs12101[rCesF42A9.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 12/17/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12364 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10569. Description: sIs10569 [rCes C05D11.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12365 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12365. Description: sEx12365 [rCes C47E12.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12367 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12367. Description: sEx12367 [rCes ZK593.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12371 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12371. Description: sEx12371 [rCes F40F11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12372 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12372. Description: sEx12372[rCesF26F4.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12378 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12378. Description: sEx12378 [rCes C45G9.10a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12380 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13480. Description: sEx13480 [rCes F58B3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: xx Made by: Allan Mah Received: 05/05/09 University of British Columbia ----------------------------------------------------------------------------- Strain: BC12382 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12382. Description: sEx12382 [rCesC35D10.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/17/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12383 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12383. Description: sEx12383 [rCes C35D10.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12384 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12384. Description: sEx12384 [rCesC35D10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 03/02/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12385 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12385. Description: sEx12385 [rCes F26A1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12386 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12386. Description: sEx12386 [rCes F26A1.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12389 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12389. Description: sEx12389 contains [rCesF26A1.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 03/03/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC124 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) unc-37(s80)/unc-15(e73) I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncLet larvae are abnormal. Pick WT to maintain. Mutagen: Outcrossed: x Made by: Received: 09/01/82 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12400 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx15005. Description: sEx12400 [rCesF45E1.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). [NOTE: (07/15/2019) This strain was incorrectly annotated as carrying sEx15005. The correct transgene name is sEx12400.] Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 07/23/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12401 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10527. Description: sIs10527 [rCes ZK637.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12407 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12407. Description: sEx12407 [rCesT04A8.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12408 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12408. Description: sEx12408 [rCes T04A8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12414 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12414. Description: sEx12414 [rCesF10F2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/11/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12415 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10601. Description: sIs10601[rCesK08E3.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Simon Wong Received: 06/19/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12416 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10631. Description: sIs10631 [rCes Y39B6A.35::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12417 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10638. Description: sIs10638 [rCes Y43F4A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12418 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12097. Description: sIs12097 [rCes T10F2.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12419 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10629. Description: sIs10629 [rCesY39A1A.15b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 05/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12420 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12076. Description: sIs12076 [rCesC34F11.9a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 04/03/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12421 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12421. Description: sEx12421[rCesY49E10.6 + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 06/04/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12422 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12422. Description: sEx12422 [zip-8a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 12/18/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12423 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12423. Description: sEx12423 [rCes F23F12.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12430 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12430. Description: sEx12430 [rCes C56G2.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12431 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12431. Description: sEx12431 [rCesC09E7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/23/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12436 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12436. Description: sEx12436 [rCes M88.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12438 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12438. Description: sEx12438 [rCes R07E5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12442 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12442. Description: sEx12442[rCes R07E5.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12457 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12457. Description: sEx12457 [rCes F54D8.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12466 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12466. Description: sEx12466 [rCes F35G12.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12468 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12468. Description: sEx12468 [rCesF56F3.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 01/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12469 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10796. Description: sIs10796 [rCes ZC395.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 10/11/24 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12473 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11776. Description: sIs11776 [rCesC10H11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Simon Wong Received: 11/10/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12475 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11667. Description: sIs11667 [rCesW05E10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12476 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11659. Description: sIs11659 [rCes M106.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12478 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10597. Description: sIs10597 [rCes F35A5.8a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12480 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12480. Description: sEx12480 [rCes C23G10.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12482 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12482. Description: sEx12482 [rCes C18F10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12485 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12485. Description: sEx12485 [rCes T12A2.16a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12486 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12486. Description: sEx12486 [rCesC50C3.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/23/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12487 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12487. Description: sEx12487 [rCesC50C3.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 09/07/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12489 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12489. Description: sEx12489 [rCes D2007.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12491 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12491. Description: sEx12491 [rCes K06H7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12493 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12493. Description: sEx12493 [rCes K06H7.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12494 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12494. Description: sEx12494 [rCes K12H4.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC125 Species: Caenorhabditis elegans Genotype: dpy-14(e188) unc-13(e51) let-79(s81)/unc-15(e73) I. Description: Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae that die in early larval development. Pick WT to maintain. Note 5/92: probably has lost dpy-14. Mutagen: EMS Outcrossed: x Made by: Ann Rose Received: 09/01/82 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12501 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12501. Description: sEx12501 [rCes F26F4.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/25/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12510 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12510. Description: sEx12510 [rCesT10B5.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 12/16/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12513 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11146. Description: sIs11146 [rCes F40F9.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12514 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10566. Description: sIs10566 [rCes Y73B6BL.19::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12515 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11147. Description: dpy-5(e907)/dpy-5(e907); sIs11147 [rCes F54D8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 10/07/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12517 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10541. Description: sIs10541[rCesF56E3.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 02/26/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12523 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12523. Description: sEx12523[rCesF54H12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12526 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10120. Description: sIs10120 [rCesC36E8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: Anthony Lee Received: 04/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12531 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12531. Description: sEx12531 [rCes F17C8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12533 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12533. Description: sEx12533 [rCes F17C8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12534 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12534. Description: sEx12534 [rCesC38D4.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12535 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12535. Description: sEx12535 [rCesF26A1.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12540 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12540. Description: sEx12540 [rCes C45G9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12544 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10314. Description: sIs10314 [rCesC06B3.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12550 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12550. Description: sEx12550 [rCes C08C3.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 01/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12551 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12551. Description: sEx12551 [rCes ZK652.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12557 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12557. Description: sEx12557 [rCes T04A6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12579 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12579. Description: sEx12579 [rCesF56C9.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 10/24/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12584 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12584. Description: sEx12584 [rCesT20H4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12591 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12591. Description: sEx12591[rCesT05C12.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/03/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12592 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11722. Description: sIs11722[rCesF19C6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 01/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12595 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12125. Description: sIs12125 [rCesAH6.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 07/24/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12597 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12174. Description: sIs12174 [rCes C47A10.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12601 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12601. Description: sEx12601[rCesF44B9.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/22/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12604 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12604. Description: sEx12604 [rCes F44B9.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12608 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11790. Description: sIs11790 [rCes Y50D7A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12609 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12449. Description: sIs12449 [rCesH38K22.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 10/15/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12610 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx11321. Description: sEx11321[rCesT23G5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12611 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11096. Description: sIs11096 [rCes T25G12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12615 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10898. Description: sIs10898 [rCes C26D10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12616 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12377. Description: sIs12377 [rCes C45G9.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12624 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12624. Description: sEx12624 [ceh-23::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 10/09/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12648 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11686. Description: sIs11686 [rCesF42G9.9a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 05/02/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12649 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10739. Description: sIs10739 [rCesC51E3.7a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 08/03/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12652 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11234. Description: sIs11234 [rCesC02E11.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 04/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12660 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12660. Description: sEx12660 [rCes R13A5.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12665 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11849. Description: sIs11849 [rCesC30F12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12667 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11834. Description: sIs11834 [rCesM176.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 02/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12668 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12029. Description: sIs12029 [rCesT08H4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Simon Wong Received: 06/19/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12669 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10522. Description: sIs10522[rCesC17G10.2::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12670 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11830. Description: sIs11830 [rCes F55F3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x Made by: Simon Wong Received: 01/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12673 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11859. Description: sIs11859 [rCesC53D6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lesley Chen Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12674 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10520. Description: sIs10520 [rCesF08F1.7::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12677 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11111. Description: sIs11111[rCesC32F10.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12678 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11921. Description: sIs11921[rCesJC8.10a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 02/12/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12679 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11724. Description: sIs11724 [rCesF36H1.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 12/01/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12680 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11843. Description: sIs11843 [rCes Y48E1B.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12686 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12686. Description: sEx12686 [rCes F07F6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12687 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12687. Description: sEx12687 [rCesY49A3A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 02/18/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12688 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11135. Description: sIs11135 [rCesF15A2.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 09/20/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12690 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12454. Description: sIs12454 [rCesF43C1.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: John Lin Received: 11/06/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12693 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12693. Description: sIs12693 [rCesF41E7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X ray Outcrossed: x Made by: Simon Wang Received: 10/27/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12695 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12409. Description: sIs12409 [rCes T23F11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12696 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12408. Description: sIs12408 [rCes T04A8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12701 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12328. Description: sIs12328 [rCes W02C12.3d::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Robert Hollebakken Received: 01/04/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12702 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10570. Description: sIs10570 [rCesC03G5.1::GFP + pCeh361]. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: Robert Hollebakken Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12703 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11836. Description: sIs11836 [rCes T27E9.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12704 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12466. Description: sIs12466 [rCesF35G12.8::GFP + pCeh361]. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 03/04/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12707 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10900. Description: sIs10900 [rCesC18A3.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-ray Outcrossed: x0 Made by: Anthony Lee Received: 03/03/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12711 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12711. Description: sEx12711 [rCes K07E3.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12716 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12716. Description: sEx12716 [rCes Y41D4A.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12721 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12721. Description: sEx12721[rCesF55A8.2b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 04/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12723 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12723. Description: sEx12723[rCesT14G10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 02/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12726 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12726. Description: sEx12726 [rCes C26C6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 01/27/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12729 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12729. Description: sEx12729 [rCesM88.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 05/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12735 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12735. Description: sEx12735 [rCes C31C9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12737 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12737. Description: sEx12737 [rCesD2024.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12743 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12743. Description: sEx12743[rCesC354D10.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 03/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12746 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12370. Description: sIs12370 [rCesF22B3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 05/31/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12747 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10574. Description: sIs10574 [rCesT26A5.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12748 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10585. Description: sIs10585 [rCesC03G5.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12749 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12619. Description: sIs12619 [rCes C29E4.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12750 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12375. Description: sIs12375 [rCesR144.10::GFP + pCeh361]. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: Simon Wong Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12752 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11234. Description: sIs11234 [rCesC02E11.1a::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12753 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12371. Description: sIs12371[rCesF40F11.2::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12754 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12567. Description: sIs12567 [rCesC07H6.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12755 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12541. Description: sIs12541[rCesR144.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: Robert Hollebakken Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12758 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12445. Description: sIs12445 [rCesF35G12.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x Made by: Robert Hollebakken Received: 01/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12759 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10744. Description: sIs10744 [rCesC48A7.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 04/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12760 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12629. Description: sIs12629 [rCesZK112.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 05/02/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12762 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11268. Description: sIs11268 [rCesM03F4.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12763 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11131. Description: sIs11131 [rCesF52B5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 09/20/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12764 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11131. Description: sIs11131 [rCes F41G3.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12765 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12335. Description: sIs12335 [rCes R151.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12766 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11844. Description: sIs11844 [rCes F18F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12767 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11856. Description: sIs11856 [rCes CD4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12772 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12772. Description: sEx12772[rCesF08C6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/25/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12775 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12775. Description: sEx12775 [rCesF28F9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 01/20/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12777 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12777. Description: sEx12777 [rCesF53H8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 01/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12778 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12778. Description: sEx12778 [rCesC26C6.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 02/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12784 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11831. Description: sIs11831[rCesK11D2.2::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12786 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11990. Description: sIs11990 [rCesY106G6E.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Simon Wong Received: 01/24/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12789 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11174. Description: sIs11174 [rCesT01C8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12790 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10518. Description: sIs10518 [rCes Y17G7B.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: John Lin Received: 01/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12791 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12533. Description: sIs12533 [rCes F17C8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12792 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12792. Description: sIs12792[rCesF41E7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X ray Outcrossed: x Made by: Anthony Lee Received: 10/27/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12794 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11178. Description: sIs11178 [rCesR166.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Gamma Outcrossed: x0 Made by: Anthony Lee Received: 04/22/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12795 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12530. Description: sIs12530 [rCes C45G9.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12796 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12796. Description: sEx12796 [rCesB0336.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/31/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12798 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12798. Description: sEx12798 [rCes ZK470.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12801 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12801. Description: sEx12801 [rCes B0303.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12803 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12803. Description: sEx12803 [rCes Y18D10A.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12805 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12805. Description: sEx12805 [rCes Y39A1A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12810 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12810. Description: sEx12810 [rCes R144.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Domena Tu Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1282 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-62(s472) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. Unc-62 is a recessive lethal. Mutagen: No mutagen used-control screen Outcrossed: x Made by: R. Rosenbluth Received: 07/01/85 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12827 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12827. Description: sEx12827 [rCes K03B8.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1283 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf20/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Made by: R. Rosenbluth Received: 10/01/85 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12833 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12501. Description: sIs12501 [rCes F26F4.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12834 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11238. Description: sIs11238 [rCesC28H8.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-ray Outcrossed: x0 Made by: Simon Wong Received: 04/06/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12835 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11012. Description: sIs11012 [rCes ZK384.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12836 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11268. Description: sIs11268 [rCesM03F4.7::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12838 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12375. Description: sIs12375 [rCes R144.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12839 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12655. Description: sIs12655 [rCesF48F7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Gamma radiation Outcrossed: x0 Made by: Robert Hollebakken Received: 03/15/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12840 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10927. Description: sIs10927 [rCesC29E4.8::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12842 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12661. Description: sIs12661[rCesR13A5.9::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12843 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11286. Description: sIs11286 [rCesK07H8.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 03/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12844 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12662. Description: sIs12662 [rCes F53F10.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12845 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12541. Description: sIs12541[rCesR144.11::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12846 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12642. Description: sIs12642 [rCes F08F8.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12847 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10473. Description: sIs10473 [rCes C30H6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12848 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11450. Description: sIs11450 [rCesK08C7.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12849 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12328. Description: sIs12328 [rCes W02C12.3d::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12850 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11836. Description: sIs11836 [rCesT27E9.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12851 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10570. Description: sIs10570 [rCesC03G5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12852 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12852. Description: sEx12852[rCesT16G1.8::GFP + pCeh361].. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 09/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12856 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12856. Description: sEx12856 [rCes K10C2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 01/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1287 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf26/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Made by: Received: 07/01/85 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12877 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12877. Description: sEx12877 [rCes Y55F3AM.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12878 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12878. Description: sEx12878 [rCesY37A1B.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 10/28/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12879 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12879. Description: sEx12879 [rCes Y55F3AM.3b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12881 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12881. Description: sEx12881 [rCes ZK512.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/28/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12883 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12883. Description: sEx12883 [rCes F11E6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12884 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12884. Description: sEx12884 [rCes F11E6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12886 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12886. Description: sEx12886 [rCes ZK643.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12889 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12639. Description: sIs12639 [rCes C07H6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1289 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; sDf28 unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Made by: R. Rosenbluth Received: 07/01/85 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12890 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11337. Description: sIs11337 [rCesY37A1B.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12891 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11014. Description: sIs11014 [rCes F25B4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12892 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11756. Description: sIs11756 [rCesZC373.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12893 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11050. Description: sIs11050 [rCesF22F7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x Made by: Robert Hollebakken Received: 01/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12895 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12655. Description: sIs12655 [rCesF48F7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12896 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11718. Description: sIs11718 [rCes T27F6.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12897 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12060. Description: sIs12060 [rCesZK430.2::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12898 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11074. Description: sIs11074 [rCesC47B2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12899 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12687. Description: sIs12687 [rCes Y49A3A.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12900 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11600. Description: sIs11600 [rCesE03G2.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12902 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12902. Description: sEx12902 [rCes F56F3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12907 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10558. Description: sIs10558 [rCes T09B4.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12908 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12631. Description: sIs12631 [rCes ZK112.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12909 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12641. Description: sIs12641[rCesF08F8.9a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 10/15/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1291 Species: Caenorhabditis elegans Genotype: let-93(s734) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Description: Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. Mutagen: EMS Outcrossed: x Made by: Leo Donati Received: 12/12/88 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12912 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12716. Description: sIs12716 [rCes Y41D4A.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12913 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10486. Description: sIs10486 [rCesZK721.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Bombardment Outcrossed: x0 Made by: Robert Hollebakken Received: 07/02/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12914 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10939. Description: sIs10939 [rCes F47B3.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Bombardment Outcrossed: x0 Made by: Robert Hollebakkan Received: 08/10/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12915 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11033. Description: sIs11033[rCesF23B12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakkan Received: 03/16/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12917 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12341. Description: sIs12341[rCesB0280.7::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12918 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11087. Description: sIs11087 [rCesF56A12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: Robert Hollebakken Received: 04/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12919 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10987. Description: sIs10987 [rCesD1054.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-ray Outcrossed: x0 Made by: John Lin Received: 03/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12921 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10729. Description: sIs10729 [rCes T12G3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 02/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12923 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12801. Description: sIs12801 [rCes B0303.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12924 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12798. Description: sIs12798 [rCesZK470.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 06/23/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12925 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10312. Description: sIs10312[rCesC05D11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Anthony Lee Received: 02/23/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12926 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12782. Description: sIs12782 [rCes K04D7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12927 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12803. Description: sIs12803 [rCesY18D10A.6a::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12933 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12933. Description: sEx12933[rCesK08F8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12934 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12169. Description: sIs12169 [rCesT19D2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12935 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11974. Description: sIs11974 [rCes C27D6.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12941 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12941. Description: sEx12941 [rCes F56D1.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12944 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12944. Description: sEx12944 [rCes T26E3.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12952 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12952. Description: sIs12952 [rCes ZK112.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Simon Wong Received: 01/19/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12954 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12954. Description: sIs12954 [rCesC35D10.14::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12956 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12739. Description: sIs12739 [rCesF25G6.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12963 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12963. Description: sEx12963[rCesF09D12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 03/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12967 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12797. Description: sIs12797 [rCesY57G11C.20::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with low intensity GFP expression in larval and adult. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12969 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12774. Description: sIs12774 [rCesF52H2.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12970 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11293. Description: sIs11293 [rCes Y71H10B.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12986 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12773. Description: sIs12773 [rCesF09C3.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-ray Outcrossed: x0 Made by: Simon Wong Received: 03/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12987 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12810. Description: sIs12810 [rCes R144.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12988 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12777. Description: sIs12777 [rCesF53H8.2::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC12989 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12989. Description: sEx12989 [rCes F10E9.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12991 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx12991. Description: sEx12991 [rCes E02D9.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12993 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11169. Description: sIs11169 [rCes C33H5.18a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12994 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12736. Description: sIs12736 [rCesC35B1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Gamma Outcrossed: x0 Made by: Simon Wong Received: 04/22/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12995 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11076. Description: sIs11076 contains [rCes C47B2.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Simon Wong Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12996 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10871. Description: sIs10871 [rCes ZK829.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12997 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12740 . Description: sIs12740 [rCes T04A8.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC12998 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10951. Description: sIs10951[rCesK03A11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: John Lin Received: 04/05/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13002 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10510. Description: sIs10510 [rCes D2013.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13003 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12880. Description: sIs12880 [rCesC26F1.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages, but rapid decrease in adults. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13008 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13008. Description: sEx13008 [rCesH22D14.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/23/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13013 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13013. Description: sEx13013 [rCes R01H10.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13032 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13032. Description: sEx13032 [rCes Y97E10AR.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13035 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13035. Description: sEx13035 [rCes K07G5.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13037 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13037. Description: sEx13037 [rCesDY3.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/21/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13049 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13049. Description: sEx13049 [rCes Y39A1C.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13051 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13051. Description: sEx13051 [rCes F29D11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13072 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13072. Description: sEx13072[rCesVF11C1L.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 02/13/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13073 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12930. Description: sIs12930 [rCes F56F10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13074 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12775. Description: sIs12775 [rCesF28F9.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13075 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13075. Description: sEx13075 [rCesC53C11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/23/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13081 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12018. Description: sIs12018 [rCesB0228.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lesley Chen Received: 11/27/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13083 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12735. Description: sIs12735 contains [rCes C31C9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Robert Hollebakken Received: 10/21/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13088 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13088. Description: sEx13088 [rCes E02D9.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13105 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13105. Description: sEx13105 [rCes Y37E3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13132 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13132. Description: sEx13132[rCesH22D14.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/23/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13135 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13135. Description: sEx13135 [rCesW05B2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/23/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13136 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13136. Description: sEx13136 [rCes C27D6.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13142 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13142. Description: sEx13142 [rCes T01A4.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13144 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13144. Description: sEx13144 [rCes F21D5.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13145 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13145. Description: sEx13145 [rCesF09E5.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13147 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13147. Description: sEx13147 [rCes W08E3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13149 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13149. Description: sEx13149 [rCes F15G9.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13170 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12260. Description: sIs12260 [rCesF25H2.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13172 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12730. Description: sIs12730 [rCesM88.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 05/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13176 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13176. Description: sEx13176 [rCes Y66D12A.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13183 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13183. Description: sEx13183 [rCes H01G02.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13193 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13193. Description: sEx13193 [rCes F11C1.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13200 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13200. Description: sEx13200 [rCesZK520.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13201 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13201. Description: sEx13201 [rCes F01F1.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13219 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12966. Description: sIs12966 [rCesW05E7.3::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13222 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12984. Description: sIs12984 [rCesY75B8A.20::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 02/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13227 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13227. Description: sEx13227 [rCes K08E7.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13241 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13241. Description: sEx13241[rCesY22F5A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/12/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13243 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13243. Description: sEx13243 [rCes Y56A3A.18::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13244 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13244. Description: sEx13244 [rCesT27A1.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13248 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12963. Description: sIs12963 [rCesF09D12.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: John Lin Received: 04/27/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13250 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13000. Description: sIs13000 [rCesT27F7.3b::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13253 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13253. Description: sEx13253 [rCesY54E2A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/31/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13255 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13255. Description: sEx13255 [rCesT02C5.5b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/20/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13256 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13256. Description: sEx13256 [rCes Y37D8A.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13258 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13258. Description: sEx13258 [rCesZK524.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/02/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13261 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13261. Description: sEx13261[rCesF32A6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13263 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13263. Description: sEx13263 [rCes F25B4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13266 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13266. Description: sEx13266 [rCesC04E12.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 03/06/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13283 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12964. Description: sIs12964 [rCesY87G2A.15::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13287 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13287. Description: sEx13287 [rCes C36E8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13292 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13292. Description: sEx13292[rCesC02C6.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/11/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13303 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12531. Description: sIs12531 [rCes F17C8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13305 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12563. Description: sIs12563 [rCesR13A5.6::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 02/08/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13306 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12555. Description: sIs12555 [rCes T04A6.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13307 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12976. Description: sIs12976 [rCes C34B2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13308 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12201. Description: sIs12201[rCesR07B7.11::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13309 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13309. Description: sEx13309 [rCesF35G12.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Zhongying Zhao Received: 06/19/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13310 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13310. Description: sEx13310 [rCesM04F3.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 03/24/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13313 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13313. Description: sEx13313 [rCesF25H8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13318 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13318. Description: sEx13318 [rCesC04C3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).. Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13333 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13333. Description: sEx13333 contains [rCes Y48C3A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Domena Tu Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13335 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13109. Description: sIs13109 [rCesY73B6BL.30::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x0 Made by: Lesley Chen Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13336 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13113. Description: sIs13113 [rCesY110A7A.20::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13337 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12928. Description: sIs12928 [rCesY39B6A.19::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 06/07/13 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13348 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13348. Description: sEx13348 [rCesK08F4.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/16/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13350 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13350. Description: sEx13350 [rCes R74.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13354 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11457. Description: sIs11457 [rCesR10H10.5::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13361 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13361. Description: sEx13361[rCesH09G03.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/03/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13365 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13365. Description: sEx13365 [rCesC54D10.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 11/06/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13370 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13370. Description: sEx13370 [rCes C27H6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13371 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13371. Description: sEx13371[rCesC29E6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 07/18/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13375 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13375. Description: sEx13375 [rCesY53C12B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13378 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13378. Description: sEx13378 [rCes h06h21.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/21/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13380 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13380. Description: sEx13380 [rCes W08D2.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13391 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13391. Description: sEx13391[rCesC09D8.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/06/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13401 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12199. Description: sIs12199 [rCes T26E3.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13403 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13403. Description: sEx13403[rCesF55C7.7a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/31/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13412 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13412. Description: sEx13412 [rCes Y105E8A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13418 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13418. Description: sEx13418 [rCesT26A5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Domena Tu Received: 10/28/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13422 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13422. Description: sEx13422 [rCes T11F9.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13429 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13429. Description: sEx13429 [rCes R11A8.7a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13430 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13430. Description: sEx13430 [rCesC52E12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13431 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13431. Description: sEx13431 [rCes F38E9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13436 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13436. Description: sEx13436 [rCesT08B2.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Zhongying Zhao Received: 04/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13443 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13443. Description: sEx13443 [rCesF36H2.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13446 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13446. Description: sEx13446 [rCes Y44A6B.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13447 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13447. Description: sEx13447 [rCesC11E4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/17/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13455 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13455. Description: sEx13455 [rCes F58G4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13458 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13458. Description: sEx13458 [rCes F10A3.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13459 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13459. Description: sEx13459 [rCesY22D7AL.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13460 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13460. Description: sEx13460 [rCes F46C5.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13467 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13467. Description: sEx13467 [rCes T23F4.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13470 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13470. Description: sEx13470 [rCes K03B8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13471 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13471. Description: sEx13471[rCesT04G9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13472 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13472. Description: sEx13472 [rCes F31C3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13480 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13480. Description: sEx13480 [rCes F58B3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13483 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13483. Description: sEx13483[rCesW06H8.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/12/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13488 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13488. Description: sEx13488 [rCesF31B12.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/20/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13491 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12001. Description: sIs12001 [rCes T06G6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13494 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13494. Description: sEx13494 [rCesC27A7.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/17/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13495 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13495. Description: sEx13495 [rCesF47B10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/02/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13501 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13501. Description: sEx13501[rCesK01C8.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/25/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13503 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13503. Description: sEx13503[rCesF58H1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/15/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13515 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13209. Description: sIs13209 [rCesF41E6.13a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lesley Chen Received: 02/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13516 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13245. Description: sIs13245 [rCes F42E11.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13517 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11997. Description: sIs11997 [rCes F49E12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13518 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13281. Description: sIs13281 contains [rCes C09G12.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Robert Hollebakken Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13519 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13260. Description: sIs13260 [rCes T19A5.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13520 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13244. Description: sIs13244 [rCesT27A1.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Robert Hollebakken Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13533 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11984. Description: sIs11984 [rCesC50E10.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Edmund Tang Received: 07/23/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13535 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13247. Description: sIs13247 [rCesC40C9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Edmund Tang Received: 10/28/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13539 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13539. Description: sEx13539 [rCesT04D3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 10/11/24 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13544 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13544. Description: sEx13544 [rCesC09E10.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 10/11/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13545 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13645. Description: sEx13645 [rCesC04F12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13557 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13557. Description: sEx13557 [rCesT12D8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/22/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13558 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13558. Description: sEx13558 [rCesF41C6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13560 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13559. Description: sIs13559 contains [rCesH27M09.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Marco Gallo Received: 01/19/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13565 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13565. Description: sEx13565 [rCes Y95B8A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13567 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13567. Description: sEx13567 [rCesC32D5.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/17/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13568 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13568. Description: sEx13568 [rCesT12D8.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13574 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13574. Description: sEx13574 [rCes T09A12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13583 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10487. Description: sIs10487 [rCesB0304.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lesley Chen Received: 05/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13587 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10381. Description: sIs10381 [rCesF43G9.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Edmund Tang Received: 02/19/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13595 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13595. Description: sEx13595 [rCesW03F9.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Replaces strain BC11329. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/02/14 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13600 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13600. Description: sEx13600 [rCes K11G12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13603 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13603. Description: sEx13603[rCesZK512.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 05/21/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13607 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13607. Description: sEx13607 [rCesB0403.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13608 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13608. Description: sEx13608 [rCesC52B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 03/24/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13611 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13611. Description: sEx13611 [rCes M04C9.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13616 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13137. Description: sIs13137 [rCes C43C3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13623 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13623. Description: sEx13623 [rCes K07C11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13624 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13624. Description: sEx13624 [rCes Y71F9B.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13627 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13627. Description: sEx13627 [rCes T10F2.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13632 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13632. Description: sEx13632[rCesF55H2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 04/16/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13635 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13635. Description: sEx13635 [rCes T28D6.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13637 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13637. Description: sEx13637 [rCes Y71F9AL.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13643 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13643. Description: sEx13643 [rCes C04A11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13645 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13645. Description: sEx13645 [rCesC04F12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13653 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13653. Description: sEx13653 [rCes W06H3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13657 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13657. Description: sEx13657 [rCesY66H1B.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/08/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13658 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13658. Description: sEx13658 [rCesW09C5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 09/13/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13659 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13659. Description: sEx13659 [rCesF37H8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Received: 08/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13660 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13660. Description: sEx13660 [rCesF37H8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13667 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13264. Description: sIs13264 [rCes F25B4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13672 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13672. Description: sEx13672 [rCesY105E8A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 11/04/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13675 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13675. Description: sEx13675 [rCes F41E6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13679 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13679. Description: sEx13679 [rCesC07D10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13683 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13683. Description: sEx13683[rCesF40E10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/11/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13686 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13686. Description: sEx13686 [rCesR11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 12/01/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13691 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13691. Description: sEx13691[rCesF16A11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13693 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13693. Description: sEx13693 [rCes ZK256.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13697 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13697. Description: sEx13697 [rCesY48G8AL.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/22/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13699 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13699. Description: sEx13699 [rCesZC116.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/23/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13701 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13701. Description: sEx13701 [rCes C02H7.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/25/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13702 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13702. Description: sEx13702 [rCes F14B4.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13705 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13705. Description: sEx13705 [rCesR06B10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13706 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13706. Description: sEx13706 [rCesC53A5.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/03/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13708 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13708. Description: sEx13708 [rCesF28C12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/03/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13711 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13711. Description: sEx13711 [rCes F28C12.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13714 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13714. Description: sEx13714 [rCes C08F8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13719 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13291. Description: sIs13291 [rCes F48E3.3::GFP + pCeh361] Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-rays Outcrossed: x Made by: Lesley Chen Received: 01/17/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13725 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13725. Description: sEx13725 [rCes W02A11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13726 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13726. Description: sEx13726 [rCes Y111B2A.18::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13727 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13727. Description: sEx13727 [rCes y113g7b.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13728 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13215. Description: sIs13215 [rCes Y48A6B.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13729 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12212. Description: sIs12212[rCesAH6.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Edmund Tang Received: 12/22/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13735 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13735. Description: sEx13735 [rCesF55C10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13737 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13737. Description: sEx13737 [rCesC44H4.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Allan Mah Received: 06/19/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13739 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13739. Description: sEx13739 [rCesC15F1.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13743 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13743. Description: sEx13743[rCesT19B10.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 01/03/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13747 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10161. Description: sIs10161[rCesC34E10.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lesley Chen Received: 04/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13748 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12817. Description: sIs12817 [rCesB0393.1::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 05/10/05 University of British Columbia, Vancouver ----------------------------------------------------------------------------- Strain: BC13749 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12251. Description: sIs12251 [rCes R144.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13750 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12127. Description: sIs12127 [rCesAH6.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lesley Chen Received: 01/24/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13756 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13756. Description: sEx13756 [rCesZK370.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 04/22/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13757 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13757. Description: sEx13757 [rCes Y18D10A.6b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13758 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10944. Description: sIs10944 [rCes F40F8.1b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13759 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13263. Description: sIs13263 [rCes F25B4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13765 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13765. Description: sEx13765 [rCesF47F6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/07/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13769 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13769. Description: sEx13769 [rCesF54F2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13771 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13771. Description: sEx13771[rCesC24A8.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/24/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13773 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13773. Description: sEx13773[rCesF58G1.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 02/20/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13775 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13775. Description: sEx13775 [rCes F01G4.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13776 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13776. Description: sEx13776 [rCes Y57A10A.23::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13780 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13780. Description: sEx13780 [rCes F36F2.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 08/29/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13784 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13784. Description: sEx13784 [rCesF47D12.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 05/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13785 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13785. Description: sEx13785 [rCes Y69A2AR.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13786 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13786. Description: sEx13786 [rCesF56C11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Zhongying Zhao Received: 07/05/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13793 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13793. Description: sEx13793 [rCesY54G2A.29::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 07/07/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13802 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13802. Description: sEx13802[rCesT21C12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/02/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13809 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13297. Description: sIs13297 [rCes T27B1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-ray Outcrossed: x0 Made by: Lesley Chen Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1381 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; unc-46(e177) sDf29/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. Mutagen: Gamma Rays Outcrossed: x Made by: R. Rosenbluth Received: 08/01/84 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13810 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12977. Description: sIs12977 [rCesR10E11.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: John Lin Received: 01/24/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13815 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13815. Description: sEx13815 [rCesR107.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/01/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13816 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13816. Description: sEx13816 contains [rCes R107.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 11/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13820 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs11342. Description: sIs11342[rCesC16D9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: John Lin Received: 11/21/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13822 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13822. Description: sEx13822[rCesZC416.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 03/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13824 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13824. Description: sEx13824 [rCesF19H6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 01/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13826 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13826. Description: sEx13826 [rCes F13D12.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13830 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13830. Description: sEx13830 [rCes F07A11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13836 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13836. Description: sEx13836 [rCesC38H2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 06/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13840 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13840. Description: sEx13840 [rCes Y119D3B.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13845 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13845. Description: sEx13845 [rCes C07A9.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13846 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13846. Description: sEx13846 [rCesB0213.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 11/14/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13851 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13851. Description: sEx13851 [rCes F42G9.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13858 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13858. Description: sEx13858 [rCes C42C1.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13859 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13859. Description: sEx13859 [rCes R74.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/08/11 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13861 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13252. Description: sIs13252[rCesF01G12.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Tony Luo Received: 02/06/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13862 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13862. Description: sEx13862[rCesZC84.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 03/02/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13865 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13865. Description: sEx13865 [rCesY17G9B.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 04/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13871 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13871. Description: sEx13871 [rCes F36D4.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13878 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13878. Description: sEx13878 [rCesY37E11AR.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13884 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13884. Description: sEx13884 [rCes F48E3.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13886 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13886. Description: sEx13886 [rCes T01B11.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13890 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13890. Description: sEx13890 [rCes C13G3.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13891 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13891. Description: sEx13891[rCesC06A8.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13892 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13892. Description: sEx13892[rCesC14A4.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13894 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13894. Description: sEx13894 [rCes T11F9.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13896 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13896. Description: sEx13896 [rCesC13C4.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13897 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13897. Description: sEx13897 [rCes C11H1.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13898 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13898. Description: vsEx13898 [rCesC08B11.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 11/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13899 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13899. Description: sEx13899 [rCes F54G2.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13915 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13915. Description: sEx13915 [rCes H28O16.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13916 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13916. Description: sEx13916 [rCesW09B6.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/13/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13919 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13919. Description: sEx13919 [rCes R12C12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13923 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13923. Description: sEx13923[rCesF53A9.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 07/30/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13932 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13932. Description: sEx13932[rCesZK652.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 01/31/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13936 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13936. Description: sEx13936 [rCesT03F6.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/06/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13941 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13941. Description: sEx13941 [rCes F25H2.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13951 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13951. Description: sEx13951[rCesY54E5A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 03/24/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13952 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13952. Description: sEx13952[rCesK12G11.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 09/19/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13953 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13953. Description: sEx13953 [rCes C04F12.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13954 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13954. Description: sEx13954 [rCesF10E7.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13956 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13956. Description: sEx13956 [rCesC04G6.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13961 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13961. Description: sEx13961 [rCes B0024.14b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13968 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13968. Description: sEx13968 [rCesF35H12.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13978 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13978. Description: sEx13978 [rCes F59B8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13979 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13979. Description: sEx13979 [rCes C05D11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13981 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13981. Description: sEx13981 [rCes C04C3.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13983 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13983. Description: sEx13983 [rCesY55F3AM.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/02/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13985 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13985. Description: sEx13985 [rCesC01F4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13988 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13988. Description: sEx13988 [rCes C02F5.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13996 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13996. Description: sEx13996 [rCesC03D6.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 09/28/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC13998 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx13998. Description: sEx13998 [rCesC17H11.6b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/08/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14006 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14006. Description: sEx14006 [rCesC47D12.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 11/12/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14009 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14009. Description: sEx14009 [rCesF14D12.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/07/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14010 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14010. Description: sEx14010 [rCes F49C12.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14012 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14012. Description: sEx14012[rCesT24D11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 07/18/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14014 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13316. Description: sIs13316 [rCes ZK353.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14016 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14016. Description: sEx14016 [rCesF54D7.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14023 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13333. Description: sIs13333 [rCes Y48C3A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14025 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14025. Description: sEx14025 [rCesT07F10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14027 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14027. Description: sEx14027 [rCes F46F6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14029 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14029. Description: sEx14029 [rCes C54G4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14036 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14036. Description: sEx14036 [rCesF20H11.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14038 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14038. Description: sEx14038 [rCesT26A5.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14044 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14044. Description: sEx14044 [rCes F40F9.6b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14050 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14050. Description: sEx14050 [rCes M01D7.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14052 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14052. Description: sEx14052[rCesK02A4.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 03/02/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14057 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14057. Description: sEx14057 [rCesF30A10.8a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/14/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14060 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14060. Description: sEx14060 [rCes C54D2.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14064 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14064. Description: sEx14064 [rCes F35H12.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14068 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14068. Description: sEx14068 [rCes M03A8.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14069 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14069. Description: sEx14069 [rCesW02H5.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 04/20/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14070 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14070. Description: sEx14070 [rCesF39C12.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14072 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14072. Description: sEx14072 [rCesF56E10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 04/12/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14074 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14074. Description: sEx14074 [rCesY55D5A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 08/24/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14075 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14075. Description: sEx14075 [rCes C42D8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14084 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14084. Description: sEx14084 [rCes M106.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14088 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14088. Description: sEx14088 [rCesT11B7.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14096 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14096. Description: sEx14096 [rCes C16C10.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14107 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14107. Description: sEx14107 [rCes C10G8.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14109 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14109. Description: sEx14109 [rCesC05D9.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 08/08/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14110 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14110. Description: sEx14110 [rCesC10E2.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 07/15/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14111 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14111. Description: sEx14111 [rCes C09D4.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14114 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14114. Description: sEx14114 [rCesY22D7AR.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 02/29/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14118 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14118. Description: sEx14118 [rCes B0546.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/05/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14119 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14119. Description: sEx14119 [rCes B0336.10::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14121 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14121. Description: sEx14121[rCesY116A8C.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 01/24/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14123 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14123. Description: sEx14123 [rCesY48G9A.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/12/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14126 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14126. Description: sE14126 [rCesC34D1.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). sEx14126 [rCesC34D1.3::GFP + pCeh361]. Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 03/02/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14128 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14128. Description: sEx14128 [rCes C16C10.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14129 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14129. Description: sEx14129 [rCesF20B6.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 04/18/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14130 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14130. Description: sEx14130 [rCesY69A2AR.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 08/03/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14131 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14131. Description: sEx14131 [rCes F10C1.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 12/08/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14133 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14133. Description: sEx14133[rCesB0350.2f::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 09/25/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14136 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14136. Description: sEx14136 [rCesF59G1.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 11/15/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14138 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14138. Description: sEx14138 [rCes C03B8.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 02/01/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14144 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14144. Description: sEx14144 [rCesT14F9.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 06/16/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14151 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14151. Description: sEx14151[rCesC49A1.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 07/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14153 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14153. Description: sEx14153 [rCes C34D4.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14155 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14155. Description: sEx14155 contains [rCes C39F7.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 10/01/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14160 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14160. Description: sEx14160 [rCes C33A12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14162 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14162. Description: sEx14162 [rCes C44C1.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14164 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14164. Description: sEx14164 [rCesC37C3.6b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 08/09/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14167 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13148. Description: sIs13148 [rCesR10E11.1a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Tony Luo Received: 06/08/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14172 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14172. Description: sEx14172 [rCesK08F8.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 10/20/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14175 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14175. Description: sEx14175 [rCes F32D1.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 06/07/13 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14176 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14176. Description: sEx14176 [rCesR08D7.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0. Made by: Allan Mah Received: 08/27/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14177 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14177. Description: sEx14177 [rCesT09B4.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14180 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13037. Description: sIs13037 [rCesDY3.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Tony Luo Received: 01/21/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14184 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14184. Description: sEx14184 [rCes F42G4.3b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14187 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14187. Description: sEx14187 [rCes W02A2.1::GFP + pCeh361] Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 01/17/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14193 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14193. Description: sEx14193 [rCesW09G12.4::GFP + pCeh361] Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 07/29/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14196 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14196. Description: sEx14196 [rCes ZK370.4a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14199 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12965. Description: sIs12965 [rCesT01B10.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Tony Luo Received: 10/28/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14200 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12234. Description: sIs12234 [rCesC13G5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Tony Luo Received: 08/30/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14203 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14203. Description: sEx14203[rCesF02E9.2a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 04/07/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14205 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14205. Description: sEx14205 [rCes D1046.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14206 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14206. Description: sEx14206 [rCesF33A8.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 10/04/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14211 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14211. Description: sEx14211 [rCes F25B5.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14214 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14214. Description: sEx14214 [rCes F10E9.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 01/10/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14216 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14216. Description: sEx14216 [rCesF26F12.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 05/10/05 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14220 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14220. Description: sEx14220 [rCesF09D1.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 09/08/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14221 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14221. Description: sEx14221 [rCes F15D3.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14222 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14222. Description: sEx14222 [rCes F33H2.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14224 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14224. Description: sEx14224 [rCesF18A1.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 07/05/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14225 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14225. Description: sEx14225 [rCesF21F8.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/13/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14226 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14226. Description: sEx14226 [rCes F25D1.1::GFP + pCeh361]. F25D1.1 is ppm-1.A Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14228 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14228. Description: sEx14228 [rCes F35F11.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14229 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14229. Description: sEx14229 [rCesT10H4.12::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/06/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14231 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14231. Description: sEx14231 [rCesF29F11.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Lily Fang Received: 06/08/10 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14232 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14232. Description: sEx14232 contains [rCes F38A5.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Lily Fang Received: 12/02/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14235 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14235. Description: sEx14235 [rCes R07H5.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14237 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14237. Description: sEx14237 [rCesC03H5.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Allan Mah Received: 01/04/08 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14238 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14238. Description: sEx14238 [rCes F41C3.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14239 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs12504. Description: sIs12504 [rCes F26F4.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x Made by: Tony Luo Received: 08/11/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC1424 Species: Caenorhabditis elegans Genotype: dpy-18(e364)/eT1 III; let-331(s427) unc-46(e177)/eT1 V. Description: Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Homozygous s427 is a cold sensitive sterile adult.(??) Maintain by picking WT. Mutagen: EMS Outcrossed: x Made by: Rosenbluth R Received: 11/13/90 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14240 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs10142. Description: sIs10142[rCesY54G2A.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: John Lin Received: 04/03/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14242 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13607. Description: sIs13607 [rCesB0403.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Tony Luo Received: 02/22/06 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14244 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sIs13698. Description: sIs13698 [rCes ZK836.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: X-ray Outcrossed: x0 Made by: John Lin Received: 11/08/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14245 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14245. Description: sEx14245 [rCesF56D12.5a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 07/19/07 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14247 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14247. Description: sEx14247 [rCes F42G4.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14248 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14248. Description: sEx14248 [rCes F58F6.4::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Baillie Lab Received: 12/12/12 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14251 Species: Caenorhabditis elegans Genotype: dpy-5(e907) I; sEx14251. Description: sEx14251[rCes JC8.3a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525). Mutagen: Outcrossed: x0 Made by: Domena Tu Received: 01/22/09 Simon Fraser University, Vancouver, BC ----------------------------------------------------------------------------- Strain: BC14252 Species: Caenorhabditis elegans Genotype: dpy-5