Strain Information
| Name | GLW63 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | pqn-59(utx51[mNG::3xFlag::pqn-59]) I. |
| Description | N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3’ (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62. |
| Mutagen | CRISPR/Cas9 homologous recombination |
| Outcrossed | x0 |
| Made by | Persephone Alicea (Glow Worms '20) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.