Strain Information
| Name | GLW79 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | sod-5(utx61[mScarlet-I-C1::3xMyc::sod-5]) II. |
| Description | N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Gaby Sobrevilla (Glow Worms '22) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.