FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.

Deletion of the tyrosine kinase domain of kin-8. Partial Daf-c especially on an old lawn of E. coli. Reduced daf-7 expression in ASI. Dye-filling defective in ASI. Abnormal ASI cell position. 10-20% of animals show withered (Wit) tail phenotype or defects in elongation or migration of posterior gonad. Previously called kin-8.

Nicotine-gated current reduced in body wall muscle cells. Disrupted localization of ACR-16 in body wall muscle cells.

cam-1 hypomorph. Grows best at 15C.

Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.

utkEx2 [mbr-1p::GFP + rol-6(su1006)]. Rollers.

utkEx3 [mbr-1p::GFP + rol-6(su1006)]. Rollers.

utkEx4 [mbr-1p::GFP + rol-6(su1006)]. Rollers.

Backcrossed tph-1(mg280) allele. cam-1 mutation was removed by crossing left and right of tph-1(mg280) using bli-2 and unc-4. Strain does not have withered tail defect and moves well.

Homozygous viable. Deletion of 433 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCGATGCGTTTTCAGATTCATCATTGAC; Right flanking sequence: ATTTCTAGCTTGAAATGGAGGAAAGTACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

cwEx266 [cam-1p::cam-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Unc. GFP-tagged CAM-1 rescues gm122. Generated in N2 background.