Strain Information
Name | GLW73 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | H34C03.2(utx55[mNG::3xFlag::H34C03.2]) IV. |
Description | N-terminal tag of H34C03.2 via CRISPR/Cas9 knock-in of mNeonGreen at H34C03.2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gggattgcctacactcaaatatacgtaacg 3'; Right flank: 5' ATGCCCACGCCGGAAGTGTTCCCATGGATG 3’ (4 silent mutations); gRNA: cgtaacgATGCCAACTCCCG; Cas9/sgRNA plasmid: pGLOW9; mNG^SEC^3xFlag plasmid: pGLOW106; SEC insertion allele strain: GLW72. |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | Christine Collins, Vinay Pillai, Wesley Yeung |
Laboratory | GLW |
Reference | N/A |
Sign in
or
register an account if you want to order this strain.