Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
GOU3237 C. elegans unc-70(cas983) V. Show Description
unc-70(cas983) removes nine amino acids (H590-L598) in the SCA5-associated deletion in β-spectrin by Cas9-triggered homologous recombination. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
GOU3601 C. elegans unc-70(cas1050[unc-70(delta H590-L598)::GFP]) V. Show Description
unc-70(cas1050) removes nine amino acids (H590-L598) in the SCA5-associated deletion in β-spectrin and inserts GFP at N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
CB524 C. elegans unc-70(e524) V. Show Description
Unc. Semi-dominant at 25C. M-MATING+++ 10-30%WT.
GOU3103 C. elegans unc-70(cas962[GFP::unc-70]) V. Show Description
GFP inserted at the N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
MT4818 C. elegans unc-70(n493) V. Show Description
Semi-dominant Unc.
XE1002 C. elegans unc-70(s1502) V; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Unc. Reference: Hammarlund M, et al. J Cell Biol. 2000 May 15;149(4):931-42. [NOTE: this strain grows very slowly and will take longer than usual to prepare for shipping.]
MT1676 C. elegans unc-70(n493) dpy-11(e224) V. Show Description
DpyUnc. Semidominant Unc.
MT2590 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1171)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1171 homozygotes) and dead eggs.
MT2591 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1172)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1172 homozygotes) and dead eggs.
MT2592 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1173)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygtes), arrested larvae (n493n1173 homozygotes) and dead eggs.
BC2303 C. elegans dpy-18(e364)/eT1 III; unc-46(e177) unc-70(s1502)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs and DpyUnc Lets that hatch.
BC2440 C. elegans dpy-18(e364)/eT1 III; unc-46(e177) unc-70(s1639)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs, and DpyUnc Lets that hatch.
GN517 C. elegans pgEx116. Show Description
pgEx116 [unc-70::TSmod + myo3p::mCherry]. Pick animals with red fluorescence in body wall muscle to maintain array. The tension sensor module (TSMod) was inserted into the coding sequence of unc-70. TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, which acts as an entropic nanospring suitable for estimating biologically relevant forces. Reference: Krieg M, et al. Nat Cell Biol. 2014 Mar;16(3):224-33.
GN600 C. elegans pgIs22 IV; oxIs95. Show Description
pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP]. The tension sensor module control (N-TSMod) was inserted at the N-terminus of unc-70. N-TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, but is placed at the N-terminus of UNC-70 where it is not sensitive to force. pgIs22 was a spontaneous insertion of pgEx157. Reference: Kelley M, et al. Elife. 2015 Mar 23;4.
MSB115 C elegans unc-70(mir6[loxP] mir16[loxP]) V. Show Description
Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987