Strain Information
| Name | GLW53 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. |
| Description | Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Kara McDonald (Glow Worms '21) |
| Laboratory | GLW |
| Reference | N/A |
Sign in
or
register an account if you want to order this strain.