Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
ALF63 C. elegans unc-119(ed3) III; bafIs63. Show Description
bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
APL5 C. elegans ljfSi2 I. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. Single-copy transgenic strain that expressing mTurquoise2::PH plasma membrane marker and mKate2::moesin actin binding domain in the M lineage. lfjSi2 was inserted at Chr I:2851088, near ttTi4348, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL622 C. elegans ljfSi2 I; ljfSi39 IV; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
AT28 C. elegans kyIs140 I; srf-6(yj13) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).
AUM1880 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
CL183 C. elegans him-5(e1490) srf-4(ct109) V. Show Description
Animals commonly have a protruding vulva. Unc (slow moving and non-sinusoidal body posture). Egl. Ectopic surface binding of the lectins WGA and SBA. Males are infertile and Mab-crumpled spicules and abnormal rays and lack diagonal sex muscles.
CL208 C. elegans srf-9(dv4) him-5(e1490) V. Show Description
Animals are somewhat smaller than WT and commonly have a protruding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Ectopic surface binding of the lectins WGA and SBA. Males are infertile and Mab.
CL261 C. elegans him-5(e1490) V; srf-5(ct115) X. Show Description
WT except for ectopic surface binding of wheat germ agglutinin (WGA).
CL264 C. elegans srf-8(dv38) V. Show Description
Animals are somewhat smaller than WT. Often have protuding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Males are infertile and Mab. Ectopic surface binding of lectins WGA and SBA.
COP2456 C. elegans ll">spin-4(ll">knu1099) Ill. Show Description
knu1099 is an engineered 7437 bp deletion in spin-4. Flanking sequences immediately outside of the region deleted ares: 5′ flank (forward strand), 5′- GTT CGG TGG AGC GCG CCT GCG -3’; 3′ flank (reverse strand), 5′- GTC TGT GTT GCT GTT CCT CAT -3’. In between these flanking sequences, a three-frame stop as well as a unique primer-binding sequence were inserted in place of the deleted sequence. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Flora Y & Bohnert KA. Dev Biol. 2023 Dec:504:137-148. doi: 10.1016/j.ydbio.2023.09.013. PMID: 37805103.
DCD214 C. elegans uqIs24. Show Description
uqIs24 [myo-2p::tagRFP::pab-1]. Expression of tagRFP::PAB-1 in pharyngeal muscles; assembles into stress granules after heat shock (2 hr at 32C) and forms tagRFP::PAB-1 aggregates with age at 20C. Valuable marker for aging and for studying the aggregation of RNA-binding proteins with prion-like domains. Reference: Lechler MC, et al. Cell Rep. 2017 Jan 10;18(2):454-467.
DQM1041 C. elegans bmdSi282. Show Description
bmdSi282 [^loxN^rgef-1p::mKate2-STOP-STOP-VHH4GFP::DAMc1]. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM1059 C. elegans bmdSi245 I; hda-1(bmd134[hda-1::GFP::loxP]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM1285 C. elegans bmdSi363 I; egl-43(bmd88[egl-43p::egl-43::LoxP::GFP::egl-43]) II. Show Description
bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM935 C. elegans bmdSi245 I; fos-1(bmd138[fos-1p::LoxP::GFP::fos-1]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM973 C. elegans bmdSi245 I; swsn-4(bmd63[LoxP::GFP::swsn-4]) IV. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM979 C. elegans bmdSi245 swsn-8(bmd222[(swsn-8p::swsn-8::GFP]) I. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM984 C. elegans bmdSi245 pbrm-1(st12226[pbrm-1::TY1::EGFP::3xFLAG]) I. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DR1942 C. elegans daf-2(e979) III. Show Description
This strain forms 20% dauers at 15C. At 25C there occurs about 25% embryonic arrest and about 75% L1 arrest. The e979 mutation results in an amino acid substitution, C146Y, in the ligand-binding domain of the DAF-2 receptor. [CGC received new stock of DR1942 September 2002. Previous stock was probably m41 and not e979.] [June 2004: Patrice Albert has confirmed the mutation in this stock: Repeat of sequencing for CGC collection strain DR1942 [daf-2(e979)] is complete. The strain does carry a C146Y mutation (coding strand TGC to TAC) [Mutation position is at 143, not 146, based on the amino acid sequence shown in Wormbase for daf-2. It's the C in partial sequence EKRCGPI of Exon 5.].]
GR2272 C. elegans rnp-2(mg582) IV. Show Description
CRISPR/Cas9 used to engineer a 6bp in-frame deletion in 5' coding region removing 2 amino acid residues that are conserved from yeast to human that might be critical for U1A binding to U1 snRNA Reference: Newman MA, et al. Genes Dev. 2018 May 1;32(9-10):670-681. PMID: 29739806
HW1329 C. elegans lin-41(xe11) I. Show Description
Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
HW1870 C. elegans lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) I. Show Description
Pick GFP+ Egl to maintain. Segregates GFP- lin-41(xe8) homozygotes (die by vulval bursting as young adults), lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) heterozygotes (GFP+ Egl), and lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) (GFP+ Ste Dpy). lin-41(xe8) is a deletion of let-7 binding sites in the lin-41 3'UTR. The balancer was derived from lin-41(bch28), a lin-41(0) allele in which an expression cassette that drives ubiquitous nuclear GFP from the eft-3 promoter has been inserted into the lin-41 coding sequence (Katic et al., G3 (2015) 5:1649-56). References: Katic et al., G3 (2015) 5:1649-56 for lin-41(bch28) starting allele for balancer generation. Aeschimann F, et al. (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. for balanced line. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JH3861 C. elegans meg-3(ax4502[meg-3(F705A,Y708A,Y713A, N725A)::OLLAS]) meg-4(ax3052) X. Show Description
20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.
JH4012 C. elegans gtbp-1(ax4561[gtbp-1p::IBB domain::mNeonGreen::gtbp-1 3'utr]) IV. Show Description
The Importin Beta Binding domain (IBB)::mNeonGreen reporter replaces gtbp-1 in the endogenous gtbp-1 locus. Sterile at 25C; maintain at 20C. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JK4842 C. elegans qSi29 II; unc-119(ed3) III. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK5072 C. elegans qSi29 II; unc-119(ed3) III; teIs1 IV. Show Description
qSi29 [sygl-1p(LBSmut)::H2B::GFP::sygl-1 3'end + unc-119(+)]. teIs1 [oma-1::GFP + unc-119(+)]. Superficially wild-type. Expression of H2B::GFP in the loop region of the germline. qSi29 contains 2kb upstream of the sygl-1 start with the four LAG-1 binding sites (LBS) mutated (RTGRGAA->RacRGAA) driving H2B::GFP under the control of the sygl-1 3' intergenic region. oma-1::GFP expression in oocyte cytoplasm. teIs1 rescues GFP expression in silenced germline trangenes more effectively at 25C. Reference: Kerschner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
JK6140 C. elegans nos-3(q902) II; qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6268 C. elegans qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3′UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3′UTR; the mCherry reporter 3′UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6690 C. elegans qSi422 [*rajSi50] II. Show Description
qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6692 C. elegans qSi424 [*rajSi50] II. Show Description
qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6693 C. elegans qSi425 [*rajSi50] II. Show Description
qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6694 C. elegans rajSi50 II; unc-119(ed3) III. Show Description
rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JN1709 C. elegans peIs1709. Show Description
peIs1709 [gpc-1p::FLAG::pab-1::sl2::NLS::GFP + unc-122p::mCherry]. FLAG-tagged poly(A)-binding protein (PAB-1) can be used for mRNA tagging. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602
JN1710 C. elegans peIs1710. Show Description
peIs1710 [glr-1p::FLAG::pab-1::sl2::NLS::GFP + unc-122p::mCherry]. FLAG-tagged poly(A)-binding protein (PAB-1) can be used for mRNA tagging. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602
KM48 C. elegans +/szT1 [lon-2(e678)] I; cdk-4(gv3)/szT1 X. Show Description
745 bp deletion of cdk-4 from intron I to exon3 removing putative ATP binding domain and catalytic residues. Most homozygous animals arrest at L2 due to absence of most or all postembryonic somatic cell divisions. Some germline proliferation resulting in slightly elongated gonad.
KRA235 C. elegans pha-1(e2123) III; kasEx80. Show Description
kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
KRA439 C. elegans unc-3(n3435) X; kasEx149. Show Description
kasEx149 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 200bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is been abolished; expression was observed specifically in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
KRA441 C. elegans unc-3(n3435) X; kasEx151. Show Description
kasEx151 [oig-1p(2.6kb_del)::GFP::unc-54 3'UTR + myo-2p::GFP]. Pick worms with GFP+ pharynx to maintain array. Unc. 2.6kb cis-regulatory region with 300bp deletion removing predicted LIN-39 binding site upstream of oig-1 was fused to GFP. Expression of oig-1::GFP in GABAergic motor neurons is retained, but eliminates ectopic expression in cholinergic motor neurons of the ventral nerve cord. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
LP262 C. elegans cpEx25. Show Description
cpEx25 [mrck-1(delta CRIB)::YPet + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. YPet-tagged MRCK-1 truncated upstream of the CRIB domain to inhibit binding to CDC-42. Generated in N2 background. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
MAS37 C. elegans unc-119(ed3) III; abcIs3. Show Description
abcIs3 [pie-1p::ebp-2::GFP + unc-119(+)]. Superficially wild-type. Maternal expression of EBP-2::GFP microtubule end-binding protein. In early embryos, EBP-2 encodes an EB1-like protein (end-binding) that locates to the growing tips of microtubules (not detected on depolymerizing microtubules). A strong fluorescent signal localizes to the centrosome due to high concentration of polymerizing microtubule ends. References: Gusnowski EM, Srayko M. J Cell Biol. 2011 Aug 8;194(3):377-86. Tegha-Dunghu J, et al. Methods Mol Biol. 2014;1136:103-16.
MAS94 C. elegans mei-1(ct46) unc-13(e1091) I; unc-119(ed3) III; abcIs3. Show Description
abcIs3 [pie-1p::ebp-2::GFP + unc-119(+)]. Embryonic-lethal at 25ºC due to dominant gain-of-function mutation mei-1(ct46), and Uncoordinated due to unc-13 mutation. Maternal expression of EBP-2::GFP microtubule end-binding protein. EBP-2 encodes an EB1-like protein (end-binding) that, in early embryos, locates to the growing tips of microtubules. A strong fluorescent signal localizes to the centrosomes of early embryos due to a high concentration of polymerizing microtubules. mei-1(ct46)-based ectopic microtubule severing causes mitotic spindle defects in the early embryo. References: Gusnowski EM, Srayko M. J Cell Biol. 2011 Aug 8;194(3):377-86. Tegha-Dunghu J, et al. Methods Mol Biol. 2014;1136:103-16.
MCJ213 C. elegans egl-1(cdb97) V. Show Description
Brood size slightly reduced at 25 degrees. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ217 C. elegans mir-35(cdb2 cdb4) II; egl-1(cdb97) V. Show Description
Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ219 C elegans sup-26(cdb99) nhl-2(cdb100) III; egl-1(cdb97) V. Show Description
nhl-2(cdb100) contains engineered mutations in the mir-35 binding site in the nhl-2 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the egl-1 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Slightly reduced brood size at 25C. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ259 C. elegans cex-2(cdb130) mir-35(cdb2 cdb4) II; T28D6.4(cdb133) unc-49(cdb134) IV; egl-1(cdb97) V. Show Description
Superficially wild-type. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MG617 C. elegans xsSi5 II. Show Description
xsSi5 [pie-1p::GFP::ani-1(AH+PH)::pie-1 3'UTR + Cbr-unc-119(+)] II. The RhoA biosensor consists of GFP fused to the C-terminal portion of C. elegans anillin, which contain its conserved region (AH) and pleckstrin homology (PH) domain. It lacks the N-terminal myosin- and actin-binding domains but retains its RhoA-binding domain. [NOTE: xsSi5 was originally published as mgSi5.] References: Tse YC, et al. Mol Biol Cell. 2012 Oct;23(20):4020-31.
MJS210 C elegans unc-119(ed3) III; qbcSi10 IV. Show Description
qbcSi10 [mex-5p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Germline-specific miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
MJS276 C elegans unc-119(ed3) III; qbcSi12 IV. Show Description
qbcSi112 [elt-2p::GFP::his-58::3XmiR-228(mut)::tbb-2 3’UTR + unc-119(+)] IV. Somatic miR-228 miRNA GFP reporter with a mutation in the miRNA-binding site. Reference: Dallaire et al. Dev Cell. 2018 Oct 22;47(2):239-247.e4. doi: 10.1016/j.devcel.2018.08.022. PMID: 30245155.
ML1735 C. elegans mcIs50. Show Description
mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Reference: Gally C, et al., Development. 2009 Sep;136(18):3109-19.
MLC1774 C. elegans vha-11(luc130) IV. Show Description
vha-11 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.