Strain Information
| Name | JK6690 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | qSi422 [*rajSi50] II. |
| Description | qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans." |
| Mutagen | CRISPR Repair template, mutations in upp |
| Outcrossed | x4 |
| Made by | Sarah Crittenden |
| Laboratory | JK |
| Reference | Carrick et al 2024 |
Sign in
or
register an account if you want to order this strain.