Strain Information
| Name | JK6694 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | rajSi50 II; unc-119(ed3) III. |
| Description | rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans." |
| Mutagen | none |
| Outcrossed | x4 |
| Made by | Kathrin Theil |
| Laboratory | JK |
| Reference | Theil, K., Imami, K. & Rajewsky, N. Identification of proteins and miRNAs that specifically bind an mRNA in vivo. Nature communications 10, 4205–13 (2019). Carrick et al., 2024 |
Sign in
or
register an account if you want to order this strain.