Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AUM1695 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I. Show Description
V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1747 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz146[PAZ deletion]) I. Show Description
282bp deletion (247aa-345aa) in PAZ domain of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1760 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1] viz151[D583A]) I. Show Description
Inactive RNase mutation of endogenously-tagged prg-1 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. mCherry tagged PRG-1 primarily expressed and localized in both hermaphrodite and male gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
AUM1880 C. elegans prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogenous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
BS5351 C. elegans nos-2(ok230) nos-1(gv5)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Homozygous sterile mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nos-2 nos-1 homozygotes (segregate many dead embryos). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. Reference: Hansen D, et al. Development. 2004 Jan;131(1):93-104.
CF12 C. elegans rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. Show Description
Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5.
CF65 C. elegans mab-5(e2088) III; lin-22(n372) IV; him-5(e1490) V. Show Description
mab-5 mutation affects ectodermal and mesodermal lineages. lin-22 and him-5 mutations affect neuroblast formation from the epidermal precursor cell V5.
HT115(DE3) Escherichia coli E. coli [F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase]. Show Description
Bacteria. Genotype: F-, mcrA, mcrB, IN(rrnD-rrnE)1, rnc14::Tn10(DE3 lysogen: lacUV5 promoter -T7 polymerase) (IPTG-inducible T7 polymerase) (RNAse III minus). This strain grows on LB or 2XYT plates. This strain is tetracycline resistant. Researchers using this strain should test for expression by transforming in one of the plasmids from the Fire Vector Kit (1999) (pLT76, e.g.) using standard CaCl2 transformation techniques. Biosafety Level: BSL-1.
JH1270 C. elegans nos-1(gv5) II. Show Description
No visible phenotype except for reduced brood size. Synthetic sterile with nos-2(RNAi). 1176 bp deletion starting at aa 58 in nos-1 ORF and ending 414 bp past the end of the nos-1 ORF.
JH3134 C. elegans swan-1(ax2045[V5::swan-1]) V. Show Description
V5 tag inserted at N-terminus of swan-1. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3195 C. elegans mbk-2(ax2051[V5::mbk-2]) IV. Show Description
V5 tag inserted at the N-terminus of mbk-2 isoform a. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JK5842 C. elegans fbf-2(q932[3xV5::fbf-2]) II. Show Description
q932 is 3xV5::fbf-2 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5929 C. elegans lst-1(q1004[lst-1::V5]) I. Show Description
q1004 is lst-1::V5 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK5933 C. elegans glp-1(q1000[glp-1::4xV5]) III. Show Description
Endogenous glp-1 locus tagged with 4xV5. Tagged GLP-1 rescues: glp-1(q1000) is fertile and progenitor zone looks wild-type. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK6002 C. elegans sygl-1(q1015[sygl-1::V5]) I. Show Description
q1015 is a sygl-1::V5 tagged endogenous locus. Superficially wild-type. Reference: Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
JK6011 C. elegans lst-1(q1032[*q1004]) I. Show Description
q1004[LST-1::3xV5] is the CRISPR-engineered insertion of a 3xV5 tag at the C-terminus of the endogenous lst-1 locus. q1032 is the CRISPR-engineered mutation C260S & C263S in the Zn finger domain of LST-1 (Haupt et al., 2019) in the q1004 background. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205.
JK6045 C. elegans glp-1(q1036) III. Show Description
Maintain at 15C. Germline tumor formation at 25C. A mix of fertile wild-type and proximal tumorous animals at 20C. glp-1(ar202) V5 CRISPR/Cas9 gene editing was used to insert a 3xV5 tag into C-terminus of GLP-1 between amino acids K(1209) and S(1210) using the same reagents as described for tagging wild-type GLP-1 (Sorensen et al., 2020). GLP-1 ar202V5 germlines express GLP-1 in membranes.
JK6059 C. elegans glp-1(q1035[*q1000]) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. CRISPR-engineered RAM mutations in endogenous glp-1 locus with C-terminal 4xV5 tag. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1035 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived by modification of parental strain JK5933 glp-1(q1000).
JK6063 C. elegans puf-8(q1048[3xV5::puf-8]) II. Show Description
3xV5 tag inserted into endogenous puf-8 locus via CRISPR/Cas9 engineering. Reference: Ferdous AS, et al. Development. 2023 May 1;150(9):dev201705. PMID: 37070766.
JK6080 C. elegans puf-3(q1058[3xV5::puf-3]) IV. Show Description
3x V5 epitope tags inserted into endogenous puf-3 locus. Expresses functional 3x V5-tagged PUF-3. Reference: Haupt KA, Genetics. 2020 Jan;214(1):147-161. PMID: 31740451
JK6091 C. elegans gld-3(q1065[gld-3L::1xV5]) II. Show Description
1xV5 tag inserted into endogenous gld-3 locus, specifically tagging GLD-3L isoform, via CRISPR/Cas9 engineering.
JK6099 C. elegans lag-2(q1049[lag-2::3xV5]) V. Show Description
CRISPR/Cas9 gene editing was used to insert a 3xV5 tag at the C-terminus of the endogenous lag-2 locus immediately upstream of stop codon. Animals are fertile and express LAG-2 V5 in adult DTCs.
JK6111 C. elegans sygl-1(q1054[*q943]) I. Show Description
C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory element LBS D (Yoo et al., 2004). Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6140 C. elegans nos-3(q902) II; qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6154 C. elegans lst-1(q1086 [*q1004]) I. Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif B disrupted (PIM B mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6179 C. elegans gld-2(q1100[gld-2::2xV5]) I. Show Description
2xV5 tag inserted into endogenous gld-2 locus via CRISPR/Cas9 engineering.
JK6188 C. elegans lst-1(q1115[*q1004]) I. Show Description
GGSGG linker::3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with a deletion removing a portion of the lst-1 locus. q1115 retains the N-terminal 1-210) region of LST-1. Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6203 C. elegans lst-1(q1125[*q1086]) I. Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motifs A&B disrupted (PIM AB mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6251 C. elegans apx-1(q1148[apx-1::3xV5]) V. Show Description
CRISPR/Cas9 gene editing was used to insert a 3xV5 tag inserted at the C-terminus of the endogenous apx-1 locus immediately upstream of STOP codon. Animals are fertile and express low levels of APX-1 V5 in adult DTCs.
JK6268 C. elegans qSi380 IV. Show Description
qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3′UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3′UTR; the mCherry reporter 3′UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.
JK6280 C. elegans puf-11(q1128[3xV5::puf-11]) IV. Show Description
3x V5 epitope tags inserted into endogenous puf-11 locus. Expresses functional 3x V5-tagged PUF-11. Reference: Haupt KA, Genetics. 2020 Jan;214(1):147-161. PMID: 31740451
JK6319 C. elegans lst-1(q1004[lst-1::3xV5]) sygl-1(q828) I. Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus.
JK6381 C. elegans lst-1(q1124[*q1004]). Show Description
3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif A disrupted (PIM A mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6383 C. elegans mpk-1(q1147[V5::mpk-1B] q1183[mpk-1AB::2xOLLAS]) III. Show Description
Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JK6389 C. elegans sygl-1(q1167[*q1135])) I. Show Description
C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elements LBS BCD (Yoo et al., 2004). Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6399 C. elegans lst-1(q1198[*q867]) I. Show Description
3xV5 epitope tag inserted into endogenous lst-1 locus with a 1 bp deletion in lst-1L-specific first exon tospecifically disrupt LST-1L isoform. Synthetically sterile in combination with sygl-1(lf). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.
JK6403 C. elegans mpk-1(q1147[V5::mpk-1B] q1201[mpk-1B del] q1183[mpk-1AB::2xOLLAS])/qC1 [qIs56] III. Show Description
qIs56 [lag-2p::GFP + unc-119(+)]. q1201 is a 125 bp deletion causing a frameshift in mpk-1B without affected mpk-1A. Heterozygous animals Roll and have GFP+ distal tip cells. Segregates roller GFP(+) heterozygotes and non-roller GFP(-) mpk-1 homozygotes (sterile, but form a vulva). qC1 [dpy-19(e1259) glp-1(q339) qIs26] homozygotes are not viable. Endogenous mpk-1 locus tagged with a single V5 tag inserted into the mpk-1b-specific exon to specifically label the N-terminus of the MPK-1B protein, and two tandem OLLAS tags inserted into the C-terminus, labeling both MPK-1A and MPK-1B isoforms. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
JK6468 C. elegans gld-3(q1215[*q1065]) II. Show Description
1xV5 tag inserted into endogenous gld-3 locus containing K864A & L867A engineered mutations, specifically tagging GLD-3L isoform. GLD-3L::1xV5 (K864A, L867A) animals are 30% Fog. Derived by CRISPR-engineered mutation of parental strain JK6091.
JK6526 C. elegans let-711(q1238[let-711::3xV5]) III. Show Description
GSS linker and 3xV5 tag inserted at C-teminus of endogenous let-711 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6563 C. elegans daz-1(q1254[1xV5::daz-1]) II. Show Description
1xV5 tag inserted at N-teminus of endogenous daz-1 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6594 C. elegans ife-3(q1259[1xV5::ife-3]) V. Show Description
1xV5 tag inserted at N-teminus of endogenous ife-3 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
JK6600 C. elegans lst-1(q869) sygl-1(q1167) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elementa LBS BCD (Yoo et al., 2004). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1167 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
JK6673 C. elegans fzr-1(q1290[3xV5::fzr-1]) II. Show Description
Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp.
LBV5 C. elegans str-217(ejd1) V. Show Description
DEET-resistant. ejd1 is a CRISPR/Cas9-induced mutation causing a predicted frame-shift in the first exon. WT (affected sequence between arrows): GCTTTTATTCCAAAAAACTCTCTCCCGCGTCG>CTGCTCCAAAAAAAAAA
SLE1 Escherichia coli E. coli [argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rcn14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase]. Show Description
Bacteria. E. coli carrying pAG607 (orn-1 RNAi feeding vector) for SILAC. Arg-, Lys-, AmpR, TetR. argA, lysA, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10(DE3 lysogen::lavUV5 promoter -T7 polymerase). Resistant to ampicillin and tetracycline. Reference: Larance M, et al. Nat Methods. 2011 Aug 28;8(10):849-51. Biosafety Level: BSL-1.
UV5 C. elegans sun-1(jf18) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are GFP+, and segregate non-GFP hermaphrodites which give only dead eggs. sun-1 is also called mtf-1.
AV51 C. elegans me8 X. Show Description
Homozygotes produce 10-15% XO male self progeny; nondisjuction is correlated with an increased frequency of achiasmate X chromosomes in oocyte nuclei, and an unaltered distribution of X chromosome crossovers. Heterozygotes produce 1-2% male self-progeny. Homozygotes (and XO hemizygotes) are slower growing than WT; reduced male mating efficiency. me8 disrupts the function of the cis-acting X chromosome meiotic pairing center. Molecular studies show that the me8 chromosome carries a terminal deletion that removes >70 kb from the left end of the X chromosome, including the endogenous telomere; further, a segment of chromosome V has been translocated to the left end of X, and a new telomere has been added de novo to the end of the translocated segment.
AV554 C. elegans dpy-13(e184) unc-5(ox171) IV/nT1 [qIs51] (IV;V); krIs14 V/nT1 [qIs51] (IV;V). Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. Heterozygotes are WT with GFP (GFP+ coelomocytes & GFP+ pharynx), and segregate WT GFP, arrested nT1[qIs51] aneuploids, and Dpy Unc homozygotes (GFP+ pharynx & GFP+ coelomocytes). Homozygous nT1[qIs51] inviable. Pick WT with GFP (GFP+ pharynx & GFP+ coelomocytes) and check for correct segregation of progeny to maintain. References: Robert V & Bessereau JL. EMBO J. 2007 Jan 10;26(1):170-83. doi: 10.1038/sj.emboj.7601463. PMID: 17159906. Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289.
EV57 C. elegans gls-1(ef8) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef8 homozygotes (nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Rybarska A, et al. PLoS Genet. 2009 May;5(5):e1000494.
NW1255 C. elegans seu-1(ev572) IV. Show Description
Suppresses touch receptor axon guidance defect of mec-7::unc-5.