More Fields
Strain Species Genotype
CZ25708 C. elegans prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT: [GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer: GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
MT14521 C. elegans prg-1(n4503) I. Show Description
Transposon silencing abnormal.
NL4110 C. elegans prg-1 (pk2298) I. Show Description
Superficially wildtype.
SX922 C. elegans prg-1(n4357) I. Show Description
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT.
WM161 C. elegans prg-1(tm872) I. Show Description
Temperature sensitive. Sterile at 25C. Maintain at 20C or below.
SX157 C. elegans prg-1(n4357) I; unc-22(st136) IV. Show Description
Transposon silencing normal.
SX158 C. elegans prg-1(n4357) I; unc-22(r750) IV. Show Description
Twitching due to transposon insertion in unc-22. [(07/16/2018) NOTE: A user has reported their PCR and sequence analysis suggest this strain contains does not still contain Tc3, but retains loss unc-22 function, apparently due to imprecise excision.]
SX178 C. elegans prg-1(n4357) I; unc-22(r765) IV. Show Description
Twitching due to transposon insertion in unc-22.
SX523 C. elegans prg-1(n4357) I; prg-2(n4358) IV. Show Description
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below.
SX9 C. elegans prg-1(n4503) I; prg-2(nDf57) IV. Show Description
Reduced brood size. Transposon silencing abnormal. Endogenous transposase levels increased.
SX166 C. elegans prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. Show Description
Transposon silencing normal.
SX278 C. elegans prg-1(n4357) I; prg-2(n4358) unc-22(r765) IV. Show Description
Transposon silencing normal.
SX494 C. elegans prg-1(n4503) I; prg-2(nDf57) unc-22(r750) IV. Show Description
Transposon silencing abnormal. Twitchers.
WM274 C. elegans prg-1(tm872) I; neSi14 II; unc-119(ed3) III. Show Description
neSi14 [FLAG::prg-1 + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
WM275 C. elegans prg-1(tm872) I; neSi15 II; unc-119(ed3) III. Show Description
neSi15 [FLAG::prg-1(D583A) + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.
SX1316 C. elegans mjIs144 II; unc-119(ed3) III. Show Description
mjIs144 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. piRNA sensor strain. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type with loss of piRNA sensor silencing in piRNA pathway mutants (e.g. prg-1). GFP is silenced in wild-type, expressed in piRNA pathway mutants and can be used as a simple read-out for piRNA pathway function. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8.
YL243 C. elegans unc-119(ed3) III; vrIs79. Show Description
vrIs79 [pie-1p::GFP::prg-1 + unc-119(+)]. Transgene expresses GFP::PRG-1 protein fusion. Weak GFP expression prone to silencing. Maintain stocks at 25C to retain GFP expression. Reference: Wang G, Reinke V. Curr Biol. 2008 Jun 24;18(12):861-7.