Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MT1082 C. elegans egl-1(n487) V. Show Description
Egg-laying defective. Retains late stage eggs. Semi-dominant. Males mate successfully. Egg-laying serotinin sensitive and imipramine resistant.
MT2060 C. elegans egl-1(n987) V. Show Description
Egl. Dominant allele. Reference: Genetics 121(4):703-21 (1989).
MT2236 C. elegans egl-1(n4065) V. Show Description
Egl. [10/02: This strain was previously listed as being sel-10(n1069) or egl-41(n1069); these were found to be incorrect and the mutation is now called egl-1(n4065). H. Schwartz comm.]
MT2251 C. elegans egl-1(n1084) V. Show Description
Egl. Semi-dominant allele. Reference: Genetics 121(4):703-21 (1989).
RB1305 C. elegans egl-1(ok1418) V. Show Description
F23B12.9 Homozygous. Outer Left Sequence: caagtcaagacaaggcgaca. Outer Right Sequence: cttccgacactgtaagggga. Inner Left Sequence: ttgtgcctactcctgccttt. Inner Right Sequence: tcacagtcgtttcagcgaac. Inner Primer PCR Length: 2163. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MT8735 C. elegans egl-1(n1084n3082) V. Show Description
n3082 is a semidominant suppressor of egl-1(n1084sd) Egl- phenotype. Recessive Ced- phenotype - average of 11 extra cells in anterior pharynx. n3082 is a loss of function allele.
OH4305 C. elegans egl-1(ot282) vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. Whole genome sequenced strain.
MT2563 C. elegans ced-3(n1165) IV; egl-1(n487) V. Show Description
n1165 blocks cell death. Temperature sensitive Egl. Semi-dominant Egl.
MT3315 C. elegans ced-4(n1416) III; egl-1(n986) V. Show Description
Absence of cell death. See WBG 10(1):31.
MP130 C. elegans sup-40(lb130)/+ I; unc-8(e15) IV; egl-1(n487) V. Show Description
lb130/+ dominantly suppresses the e15 backing defect and causes recessive sterility. Three phenotypes are present in this strain: backing steriles (lb130 homozygotes), backing fertiles which are bloated (heterozygotes), and non-backing coiled Unc animals which are fertile and bloated (sup-40(+)). Maintain strain by picking fertile animals which can back. egl-1(n487) is included in the strain to facilitate identification of lb130 homozygotes, which grow slowly; their sterility contrasts with the bloating of lb130/+ heterozygotes.
MT2845 C. elegans egl-5(n945) III; him-5(e1467) egl-1(n986) V. Show Description
n945: HSN- . Egl. Coiler.
MT2663 C. elegans sqt-3(sc63) him-5(e1467) egl-1(n986) unc-76(e911) V. Show Description
Dominant Egl. Unc. Dpy (ts). Throws males.
CX7102 C. elegans lin-15B&lin-15A(n765) qaIs2241 X. Show Description
qaIs2241 [gcy-36::egl-1 + gcy-35::GFP + lin-15(+)].
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
JPS1809 C. elegans vxIs601; bcIs49. Show Description
bcIs49 [egl-1p::mitoGFP]. vxIs601 [egl-1p::mCherry::egl-1 3'UTR + unc-122p::GFP]. Transcriptional reporter for apoptotic trigger egl-1. mCherry expression in URX adult neurons through adult stage. Transient mCherry expression in apoptotic cells before death. Reference: Wu Z, et al. Proc Natl Acad Sci U S A. 2025 Jan 14;122(2):e2407909122. doi: 10.1073/pnas.2407909122. PMID: 39786930.
JPS601 C. elegans vxIs601. Show Description
vxIs601 [egl-1p::mCherry::egl-1 3'UTR + unc-122p::GFP]. Transcriptional reporter for apoptotic trigger egl-1. mCherry expression in URX adult neurons and apoptotic cells. Reference: Cohn J, et al. G3 (Bethesda). 2019 Nov 5;9(11):3703-3714. doi: 10.1534/g3.119.400654. PMID: 31519744.
JPS725 C. elegans ced-6(n1813) III; vxEx725. Show Description
vxEx725 [egl-1p::mCherry::egl-1(G55E, F65D)::egl-1 3'UTR + gcy-32p::GFP::unc-54 3'UTR + unc-122p::GFP]. Pick animals with GFP expression in coelomocytes to maintain. mCherry-tagged EGL-1 visible in URX adult neurons and apoptotic cells. G55E and F65D mutations in the BH3-only region to abolish mCherry::EGL-1 function in inducing cell death. Reference: Wu Z, et al. Proc Natl Acad Sci U S A. 2025 Jan 14;122(2):e2407909122. doi: 10.1073/pnas.2407909122. PMID: 39786930.
MCJ213 C. elegans egl-1(cdb97) V. Show Description
Brood size slightly reduced at 25 degrees. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ217 C. elegans mir-35(cdb2 cdb4) II; egl-1(cdb97) V. Show Description
Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ219 C elegans sup-26(cdb99) nhl-2(cdb100) III; egl-1(cdb97) V. Show Description
nhl-2(cdb100) contains engineered mutations in the mir-35 binding site in the nhl-2 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the egl-1 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Slightly reduced brood size at 25C. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ259 C. elegans cex-2(cdb130) mir-35(cdb2 cdb4) II; T28D6.4(cdb133) unc-49(cdb134) IV; egl-1(cdb97) V. Show Description
Superficially wild-type. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MD5016 C. elegans egl-1(dx243[mSG::egl-1]) V. Show Description
Coding sequence for monomeric StayGold (mSG) inserted at the beginning of the 2nd exon of the endogenous egl-1 locus. mSG::EGL-1 retains close to wild-type activity (0.3 extra cells in the anterior pharynx compared to 11.9 extra cells for egl-1(n1084 n3082)).
WS1973 C. elegans opIs56. Show Description
opIs56 [egl-1p::2xNLS::GFP]. opIs56 is a low copy integrant of 3 kb 5' sequence from egl-1 fused to 2xNLS GFP. unc-119(ed3) should be outcrossed. Low basal GFP expression in embryos, meiotic germ cells and several neurons. GFP expression can be induced by ionizing radiation in all germ cells. Best viewed with dissected gonads.
XA2262 C. elegans gcy-33(ok232) V; gcy-31(ok296) X; qaIs2241. Show Description
qaIs2241 [gcy-36p::egl-1 + gcy-35p::GFP]; causes genetic ablation of AQR, PQR, and URX neurons. Some residual neurons in the tail remain GFP+ from the gcy-35::GFP transgene.
APL126 C. elegans ljfSi33 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. Show Description
ljfSi33 [myo3p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. Sex myoblast migration defects, Egl. EGL-17::mNG expression in body wall muscles. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi33 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL130 C. elegans ljfSi10 II; egl-17(ljf25[egl-17::mNG::nlg-1 C-terminus]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Endogenously membrane tethered allele of EGL-17::mNG that is competent for contact-dependent signaling but does not diffuse extracellularly. egl-17(ljf25) was generated by inserting mNG and the transmembrane and C-terminal domains of NLG-1 at the C-terminus of egl-17. Sex myoblast migration defects, Egl. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL199 C. elegans ljfSi10 II; egl-17(ljf24[egl-17::SL2::mNG::PH]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Endogenously engineered transcriptional reporter that can be used to visualize membranes of egl-17-expressing cells. egl-17(ljf24) was generated by inserting SL2::mNG::PH following the egl-17 stop codon. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL23 C. elegans ljfSi10 II; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL242 C. elegans ljfSi32 I; ljfSi10 II; egl-17(ljf14[egl-17p::mNG::3xFlag]) X. Show Description
ljfSi32 [egl-20 enhancer(-1261 – 610)::pes-10p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN]) I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. Sex myoblast migration defects, Egl. EGL-17::mNG expression in a small number of posterior cells leads to posterior sex myoblast migration in hermaphrodites. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. ljfSi32 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
APL622 C. elegans ljfSi2 I; ljfSi39 IV; egl-17(ljf7[egl-17::mNG::3xFlag]) X. Show Description
ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.
CB1313 C. elegans egl-17(e1313) X. Show Description
Egg-laying defective. Moderate to severe bloating. 30% make bags of worms. Males mate. [NOTE: Probably contains a tightly linked mutation which cannot be crossed off. Use MT3188 as reference strain. Michael Stern 6\97]
CGC135 C. elegans let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
CGC136 C. elegans mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
CGC137 C. elegans mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
CGC152 C. elegans mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC153 C. elegans mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9.  Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
CGC159 C. elegans mir-61&mir-250(umn66[mir-61p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722]) II. Show Description
mScarlet replacement of mir-61 and mir-250 pre-miRNAs. SEC has been removed, leaving the SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::let-858 3'UTR transcriptional reporter in the locus
CGC177 C. elegans lin-4(umn84[lin-4p::SL1::EGL-13NLS::lox2272::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR::lox2722])/mIn1[dpy-10(e128) umnIs33] II. Show Description
umnIs33 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. Nuclear mScarlet-I was inserted in place of the endogenous lin-4 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type mScarlet+ GFP+, and segregate wild-type mScarlet+ GFP+, Lin-4 mScarlet+ non-GFP (umn84 homozygotes), and Dpy non-mScarlet GFP+ (mIn1 homozygotes). Maintain by picking wild-type mScarlet+ GFP+. Left Flanking: AGAGTTTTGGTTGGTTTATGAGTTT, Right Flanking: CCAGGACGGTTTGAGCAGATCtttt. sgRNA: TGAGGTCTCAGGGAACAGGC.
DA1006 C. elegans egl-19(ad1006) IV. Show Description
Egl. Lon. Sluggish Unc. Eat.
DA1013 C. elegans egl-19(ad1013) IV. Show Description
Weak Egl. Weak Eat.
DA1015 C. elegans egl-19(ad1015) IV. Show Description
Egl. Weak sluggish Unc.
DA1025 C. elegans vab- (ad1026); egl-19(ad1025)/bli-6(sc16) unc-24(e138) IV. Show Description
Impenetrant Vab - mostly tail; not mapped. Strain throws early larval lethals (ad1025 homozygotes) and Bli Uncs.
DA1031 C. elegans egl-19(n582) IV; unc-2(e55) X. Show Description
Unc. Egl, Lon, Slow and Floppy.
DA1034 C. elegans egl-19(n2368) IV; unc-2(e55) X. Show Description
Unc. Semidominant Egl-c, Sma.
DA1035 C. elegans egl-19(ad695) IV; unc-2(e55) X. Show Description
Unc. Semi-dominant Eat (TB relaxation defective).
DA1042 C. elegans egl-19(ad1008) unc-24(e138) IV/nT1 [unc-?(n754) let-?] (IV;V) Show Description
Heterozygotes are Unc and segregate Uncs and dead eggs. ad1008 homozygotes are Pat.
DA1256 C. elegans lin-15B&lin-15A(n765) X; adEx1256. Show Description
adEx1256 [egl-19::sGFP-NLS + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv. n765 is temperature-sensitive.
DA695 C. elegans egl-19(ad695) IV. Show Description
Abnormal feeding. Relaxation defective. Smallish. Males don't mate. Semidominant. Previously called eat-12. See also WBPaper00002912.
DA742 C. elegans lon-2(e678) unc-6(e78) egl-15(n484) X. Show Description
Long. Uncoordinated. Egl.
DA768 C. elegans bli-6(sc16) egl-19(ad695) unc-24(e138)/nDf41 IV. Show Description
Heterozygotes are Blistered and Eat (terminal bulb relaxation defective). Heterozygotes segregate BliEat, BliEatUnc and dead eggs. ad695 previously called eat-12.