More Fields
Strain Species Genotype
MT1082 C. elegans egl-1(n487) V. Show Description
Egg-laying defective. Retains late stage eggs. Semi-dominant. Males mate successfully. Egg-laying serotinin sensitive and imipramine resistant.
MT2060 C. elegans egl-1(n987) V. Show Description
Egl. Dominant allele. Reference: Genetics 121(4):703-21 (1989).
MT2236 C. elegans egl-1(n4065) V. Show Description
Egl. [10/02: This strain was previously listed as being sel-10(n1069) or egl-41(n1069); these were found to be incorrect and the mutation is now called egl-1(n4065). H. Schwartz comm.]
MT2251 C. elegans egl-1(n1084) V. Show Description
Egl. Semi-dominant allele. Reference: Genetics 121(4):703-21 (1989).
RB1305 C. elegans egl-1(ok1418) V. Show Description
F23B12.9 Homozygous. Outer Left Sequence: caagtcaagacaaggcgaca. Outer Right Sequence: cttccgacactgtaagggga. Inner Left Sequence: ttgtgcctactcctgccttt. Inner Right Sequence: tcacagtcgtttcagcgaac. Inner Primer PCR Length: 2163. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MT8735 C. elegans egl-1(n1084n3082) V. Show Description
n3082 is a semidominant suppressor of egl-1(n1084sd) Egl- phenotype. Recessive Ced- phenotype - average of 11 extra cells in anterior pharynx. n3082 is a loss of function allele.
OH4305 C. elegans egl-1(ot282) vtIs1 V. Show Description
vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Extra cells expressing dat-1::GFP. Whole genome sequenced strain.
MT2563 C. elegans ced-3(n1165) IV; egl-1(n487) V. Show Description
n1165 blocks cell death. Temperature sensitive Egl. Semi-dominant Egl.
MT3315 C. elegans ced-4(n1416) III; egl-1(n986) V. Show Description
Absence of cell death. See WBG 10(1):31.
MP130 C. elegans sup-40(lb130)/+ I; unc-8(e15) IV; egl-1(n487) V. Show Description
lb130/+ dominantly suppresses the e15 backing defect and causes recessive sterility. Three phenotypes are present in this strain: backing steriles (lb130 homozygotes), backing fertiles which are bloated (heterozygotes), and non-backing coiled Unc animals which are fertile and bloated (sup-40(+)). Maintain strain by picking fertile animals which can back. egl-1(n487) is included in the strain to facilitate identification of lb130 homozygotes, which grow slowly; their sterility contrasts with the bloating of lb130/+ heterozygotes.
MT2845 C. elegans egl-5(n945) III; him-5(e1467) egl-1(n986) V. Show Description
n945: HSN- . Egl. Coiler.
MT2663 C. elegans sqt-3(sc63) him-5(e1467) egl-1(n986) unc-76(e911) V. Show Description
Dominant Egl. Unc. Dpy (ts). Throws males.
CX7102 C. elegans lin-15B&lin-15A(n765) qaIs2241X. Show Description
qaIs2241 [gcy-36::egl-1 + gcy-35::GFP + lin-15(+)].
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
WS1973 C. elegans opIs56. Show Description
opIs56 [egl-1p::2xNLS::GFP]. opIs56 is a low copy integrant of 3 kb 5' sequence from egl-1 fused to 2xNLS GFP. unc-119(ed3) should be outcrossed. Low basal GFP expression in embryos, meiotic germ cells and several neurons. GFP expression can be induced by ionizing radiation in all germ cells. Best viewed with dissected gonads.
XA2262 C. elegans gcy-33(ok232) V; gcy-31(ok296) X; qaIs2241. Show Description
qaIs2241 [gcy-36p::egl-1 + gcy-35p::GFP]; causes genetic ablation of AQR, PQR, and URX neurons. Some residual neurons in the tail remain GFP+ from the gcy-35::GFP transgene.
CB1313 C. elegans egl-17(e1313) X. Show Description
Egg-laying defective. Moderate to severe bloating. 30% make bags of worms. Males mate. [NOTE: Probably contains a tightly linked mutation which cannot be crossed off. Use MT3188 as reference strain. Michael Stern 6\97]
DA1006 C. elegans egl-19(ad1006) IV. Show Description
Egl. Lon. Sluggish Unc. Eat.
DA1013 C. elegans egl-19(ad1013) IV. Show Description
Weak Egl. Weak Eat.
DA1015 C. elegans egl-19(ad1015) IV. Show Description
Egl. Weak sluggish Unc.
DA1025 C. elegans vab- (ad1026); egl-19(ad1025)/bli-6(sc16) unc-24(e138) IV. Show Description
Impenetrant Vab - mostly tail; not mapped. Strain throws early larval lethals (ad1025 homozygotes) and Bli Uncs.
DA1031 C. elegans egl-19(n582) IV; unc-2(e55) X. Show Description
Unc. Egl, Lon, Slow and Floppy.
DA1034 C. elegans egl-19(n2368) IV; unc-2(e55) X. Show Description
Unc. Semidominant Egl-c, Sma.
DA1035 C. elegans egl-19(ad695) IV; unc-2(e55) X. Show Description
Unc. Semi-dominant Eat (TB relaxation defective).
DA1042 C. elegans egl-19(ad1008) unc-24(e138) IV/nT1 [unc-?(n754) let-?] (IV;V) Show Description
Heterozygotes are Unc and segregate Uncs and dead eggs. ad1008 homozygotes are Pat.
DA1256 C. elegans lin-15B&lin-15A(n765) X; adEx1256. Show Description
adEx1256 [egl-19::sGFP-NLS + lin-15(+)]. Animals with the array are WT. Animals which have lost the array are Muv. n765 is temperature-sensitive.
DA695 C. elegans egl-19(ad695) IV. Show Description
Abnormal feeding. Relaxation defective. Smallish. Males don't mate. Semidominant. Previously called eat-12. See also WBPaper00002912.
DA742 C. elegans lon-2(e678) unc-6(e78) egl-15(n484) X. Show Description
Long. Uncoordinated. Egl.
DA768 C. elegans bli-6(sc16) egl-19(ad695) unc-24(e138)/nDf41 IV. Show Description
Heterozygotes are Blistered and Eat (terminal bulb relaxation defective). Heterozygotes segregate BliEat, BliEatUnc and dead eggs. ad695 previously called eat-12.
DA929 C. elegans egl-19(n582) unc-24(e138) IV. Show Description
Unc: amber suppressible. Egl: Lon, slow and floppy.
DA939 C. elegans unc-36(e251) III; egl-19(n2368) IV. Show Description
Unc. Semidominant Egl-c, Sma.
DA944 C. elegans unc-36(e251) III; egl-19(ad695) IV. Show Description
Unc. Semidominant Eat (TB relaxation defective).
DA945 C. elegans unc-36(e251) III; egl-19(n582) IV. Show Description
Unc. Semidominant Egl, Lon, Slow and Floppy
DA949 C. elegans bli-6(sc16) egl-19(n582) unc-24(e138) IV. Show Description
Blistered cuticle. Egl-Lon, slow and floppy. Unc.
DA952 C. elegans egl-19(n582ad952) IV. Show Description
n582 is Egl, Lon, slow & floppy. Suppressed by ad952, which is semidominant. Strain is slightly Dpy and the pharyngeal bulb occasionally shows delayed relaxation and repolarization.
DA995 C. elegans egl-19(ad995) IV. Show Description
Lon. Sluggish Unc. Egl. Eat. Rubberband.
DCR1690 C. elegans cima-1(wy84) IV; egl-15(n484) wyIs45 X; olaEx1004. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1004 [F25B3.3p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1004 does not rescue egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1710 C. elegans cima-1(wy84) IV; egl-15(n484) wyIs45 X; olaEx1015. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1015 [dpy-7p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1015 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1779 C. elegans cima-1(wy84) IV; egl-15(n484) wyIs45 X; olaEx1054. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1054 [dpy-7p::egl-15(5A)(ecto) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1054 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR2335 C. elegans cima-1(wy84) IV; wyIs45 X; olaEx1411. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1411 [dpy-7p::egl-15(5A)::HA + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DR1191 C. elegans daf-12(m20) unc-27(e155) egl-15(n484) X. Show Description
Dauer defective. Egl-60% form bags of worms. Unc-sluggish, poor backing. Resistant to both imipramine and serotonin. Slightly Dpy.
EW34 C. elegans egl-18(ga97) IV. Show Description
Egl. Rol.
FK312 C. elegans sma-5(n678) X. Show Description
Made by crossing MT3353 egl-15(n484) sma-5(n678) with N2 males and selecting animals that grew much better. FK312 probably only carries the sma-5(n678) mutation but that has not been confirmed by sequencing. Small body size, slow growth, abnormal intestinal granules, shorter lifespan than WT.
FX11552 C. elegans vps-45(tm246)/egl-17(e1313) lon-2(e678) X. Show Description
Heterozygotes are WTand segregate WT, Egl Lon, and tm246 homozygotes (temperature sensitive lethal which can be maintained as homozygotes at 15C). tm246 homozygotes have endocytosis defects in oocytes and coelomocytes at 25C. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX30273 C. elegans egl-17(tmIs1224) X. Show Description
Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::Venus. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30276 C. elegans egl-17(tmIs1234) X. Show Description
Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::mCherry. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
GS3582 C. elegans unc-4(e120) II; arIs92. Show Description
arIs92[egl-17p::NLS-CFP-LacZ + unc-4(+) + ttx-3::GFP]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS4249 C. elegans unc-4(e120) II; arIs82. Show Description
arIs82 [lin-12::GFP + egl-17p::lacZ + unc-4(+)]. Reference: Shaye DD, Greenwald I. Nature. 2002 Dec 12;420(6916):686-90. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JR2370 C. elegans egl-18(ok290) IV. Show Description
JU486 C. elegans mfIs4. Show Description
mfIs4 [egl-17::YFP + daf-6::CFP + unc-119(+)]. YFP is expressed in the secondary vulval lineage (vulC, D) and CFP in the primary vulval lineage (vulE, F). egl-17::YFP from the pDRS17 plasmid (D. Sherwood and P. Sternberg). daf-6::CFP from the pCK1 plasmid (C. Kolditz and MA Felix). Slightly Egl, Pvl. unc-119(ed3) might still be present in the background.