| AH5059 |
C. elegans |
let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. Show Description
CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted). |
|
| BOX235 |
C. elegans |
dlg-1(mib23[dlg-1::mCherry-LoxP]) X. Show Description
mCherry tag inserted at the C-terminus of the endogenous dlg-1 locus. Reference: Remmelzwaal S, et al. Curr Biol. 2021 Jun 7;31(11):2334-2346.e9. doi: 10.1016/j.cub.2021.03.069. PMID: 33857431. |
|
| CB7587 |
C. elegans |
ptr-15(gk5234) V; crEx498. Show Description
crEx498 [dpy-14p::ptr-15(+) + sur-5p::GFP]. Pick animals with nuclear GFP throughout body to maintain. Lethal ptr-15 deletion allele marked with pharyngeal GFP [loxP ::myo-2p::GFP::unc-54 3’UTR + rps-27p::neoR::unc-54 3’UTR::loxP]; lethality rescued by hypodermal expression of PTR-15 form crEx498 array. Non-nuclear GFP animals (only pharyngeal expression) will be dead eggs and dead hatchlings. Derived from parental strain VC4151. References: O’Rourke et al. (in revision 2024). |
|
| CFJ108 |
C. elegans |
kstSi60 II; unc-119(ed3) III. Show Description
kstSi60 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] II. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022. |
|
| CFJ111 |
C. elegans |
kstSi61 II; unc-119(ed3) III. Show Description
kstSi61 [LoxP + Cbr-unc-119(+) + LoxP + hygroR(kst31)] II. N2-like, no hygromycin resistance (HygroR). hygroR(kst31) is a partial, non-functional hygromycin-resistance construct used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022. |
|
| CFJ184 |
C. elegans |
kstSi84 I; unc-119(ed3) III. Show Description
kstSi84 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] I. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022. |
|
| CGC58 |
C. elegans |
C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC59 |
C.elegans |
gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC61 |
C. elegans |
F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC72 |
C. elegans |
npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC73 |
C. elegans |
npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC78 |
C. elegans |
C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| CGC81 |
C. elegans |
C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
|
| COP2331 |
C. elegans |
spin-1(knu1010[spin-1::mCherry::loxP::HygR::loxP]) V. Show Description
mCherry tag inserted at the C-terminus of the endogenous spin-1 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
|
| COP2341 |
C. elegans |
spin-2(knu1018[spin-2::mCherry::loxP::HygR::loxP]) IV. Show Description
mCherry tag inserted at the C-terminus of the endogenous spin-2 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
|
| COP2343 |
C. elegans |
spin-3(knu1020[spin-3::mCherry::loxP::HygR::loxP]) X. Show Description
mCherry tag inserted at the C-terminus of the endogenous spin-3 locus via CRISPR/Cas9 engineering. This strain may not be distributed to commercial or for-profit entities without prior written permission from In Vivo Biosystems. Please contact support@invivobiosystems.com for more information. Reference: Villalobos TV, et al. Nat Aging. 2023 Sep;3(9):1091-1106. PMID: 37580394. |
|
| CZ24092 |
C. elegans |
gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826. |
|
| CZ25013 |
C. elegans |
unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707. |
|
| DG3929 |
C. elegans |
tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Show Description
tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Reference: Huelgas-Morales G., et al. G3 (Bethesda). 2016 Apr 7;6(4):1031-47. |
|
| DLW109 |
C. elegans |
wrdSi23 I; unc-104(knu973[unc-104::AID*]) II. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP::tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541 |
|
| DLW110 |
C. elegans |
wrdSi23 I; unc-18(knu969[unc-18::AID*]) X. Show Description
wrdSi23 [eft-3p::TIR1::F2A::mTagBFP::tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541 |
|
| DLW124 |
C. elegans |
wrdSi22 I; unc-52(knu968[AID*::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1::F2A::mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID*-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID*) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK, Libuda DE. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541 |
|
| DQM104 |
C. elegans |
bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075. |
|
| DQM1051 |
C. elegans |
lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
|
| DQM1059 |
C. elegans |
bmdSi245 I; hda-1(bmd134[hda-1::GFP::loxP]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles. |
|
| DQM1066 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNG-C1::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
|
| DQM1068 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNG-C1::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395. |
|
| DQM1070 |
C. elegans |
cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. |
|
| DQM1072 |
C. elegans |
cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394. |
|
| DQM1126 |
C. elegans |
icbSi228 II; unc-119(ed3) III; had-1(bmd134[had-1::GFP::loxP]) V. Show Description
icbSi228 [ttTi5605_right::wrt-2p::wcherry::Dam:linker:egl-13NLS:vhhGFP4::unc-54::unc1193'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement. |
|
| DQM1285 |
C. elegans |
bmdSi363 I; egl-43(bmd88[egl-43p::egl-43::LoxP::GFP::egl-43]) II. Show Description
bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles. |
|
| DQM300 |
C. elegans |
egl-43(bmd88[LoxP::gfp::egl-43]) II. Show Description
GFP reporter inserted internally into endogenous egl-43 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1). |
|
| DQM311 |
C. elegans |
hlh-2(bmd90[LoxP::GFP::hlh-2]) I. Show Description
GFP reporter inserted into N-terminus of endogenous hlh-2 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1). |
|
| DQM455 |
C. elegans |
cki-1(bmd132[GFP::LoxP::cki-1::3xFLAG]) II. Show Description
CRISPR/Cas9 insertion of GFP into the N-terminus of cki-1; seems to cause cki-1 gain-of-function phenotype (early cell cycle exit for some post-embryonic blast cells). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888 |
|
| DQM494 |
C. elegans |
egl-43(bmd136[LoxP::gfp::egl-43(long)]) II. Show Description
GFP reporter inserted into N-terminus of endogenous egl-43 locus specifically tags the long isoform. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1). |
|
| DQM497 |
C. elegans |
fos-1(bmd138[LoxP::gfp::fos-1]) V. Show Description
GFP reporter inserted into N-terminus of endogenous fos-1 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1). |
|
| DQM935 |
C. elegans |
bmdSi245 I; fos-1(bmd138[fos-1p::LoxP::GFP::fos-1]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles. |
|
| DQM973 |
C. elegans |
bmdSi245 I; swsn-4(bmd63[LoxP::GFP::swsn-4]) IV. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles. |
|
| DWP219 |
C. elegans |
daam-1(ups39) V. Show Description
Superficially wild-type. ups39 is a CRISPR-engineered deletion within daam-1. daam-1(ups39) encodes an in-frame stop codon near the start of its FH2-coding sequence, and a 1-nt frame shift due to the LoxP site, and is thus predicted encode a non-functional formin. Reference: Sundaramurthy S, et al. Cytoskeleton (Hoboken). 2020 Oct;77(10):422-441. doi: 10.1002/cm.21639. PMID: 33103378. |
|
| EG10048 |
C. elegans |
oxSi1213 II. Show Description
oxSi1213 [loxP::mex-5p::FLP(G5D)::SL2::mNeongreen::FRT3]; inserted into jsSi1579. Generated by RMCE. Germline expressed Flp recombinase with transpliced mNeonGreen expression reporter. Animals have bright green fluorescent germlines and can recombine FRT sites with high efficiency. Out-crossed once with N2 to remove Flp from background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400. |
|
| EG10050 |
C. elegans |
oxSi1215 II. Show Description
oxSi1215 [mex-5p::wrmCre::2xNLS::SL2::mNeonGreen::glh-2 3'UTR + Cbr-unc-119(+)]; inserted into ttTi5605. Germline expressed Cre recombinase with transpliced mNeonGreen expression reporter. Animals have bright green fluorescent germlines and recombines loxP sites with high efficiency. Out-crossed once with N2 to remove unc-119(ed3) from the background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400. |
|
| EG10276 |
C. elegans |
oxSi1356 II; unc-119(ox819) III. Show Description
oxSi1356 [attL::loxP::mex-5p::B3::let-858 3'UTR::glh-2 3'UTR::mNeongreen::SL2::PhiC31::mex-5p::rox::attR]; inserted into oxSi1270. Generated by PhIT. Germline expression of PhiC31 and B3 recombinases arranged in a convergent (tail-to-tail) manner. Unc; can be rescued by expression of the C. briggsae unc-119 gene (Cbr-unc-119). Out-crossed once with N2 to remove Flp from background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400. |
|
| EG10420 |
C. elegans |
oxSi1228 II. Show Description
oxSi1228 [loxP::mex-5p::vika::SL2::mNeongreen::FRT3]; inserted into jsSi1579. Generated by RMCE. Germline expressed Vika recombinase with transpliced mNeonGreen expression reporter. Animals have green fluorescent germlines and can recombine vox sites with low efficiency. Out-crossed once with N2 to remove Flp from background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400. |
|
| EG10421 |
C. elegans |
oxSi1190 II. Show Description
oxSi1190 [loxP::mex-5p::Bxb1::tbb-2UTR::FRT3]. Inserted into jsSi1579. Generated by RMCE. Germline expressed Bxb1 integrase. Animals recombine Bxb1 attB and attP sites with low efficiency. Out-crossed once with N2 to remove Flp from background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400. |
|
| EG10441 |
C. elegans |
oxSi1284 II. Show Description
oxSi1284 [loxP::mex-5p::B3::SL2::mNeongreen::FRT3]; inserted into jsSi1579. Generated by RMCE. Germline expressed B3 recombinase with transpliced mNeonGreen expression reporter. Animals have green fluorescent germlines and can recombine B3RT sites. Out-crossed once with N2 to remove Flp from background. Reference: Hefel A, et al. bioRxiv. 2026 Jan 15:2026.01.15.699741. doi: 10.64898/2026.01.15.699741. PMID: 41648400. |
|
| EG10481 |
C. elegans |
oxSi1411 I; unc-119(ed3) III. Show Description
oxSi1411 [elo-5p::CyOFP(loxP::attB::loxP)::tbb-2 3'UTR + unc-119(+)]; inserted into oxTi185 I. PhiC31 attB landing pad contained within Pelo-5::CyOFP (attB site is flanked by loxP sites). Reference: Rich MS, et al. bioRxiv. 2025 Nov 12:2025.11.11.687718. doi: 10.1101/2025.11.11.687718. PMID: 41293020. |
|
| EG10570 |
C. elegans |
mnDf61/mnC1 [dpy-10(e128) unc-52(e444) umnIs32] II; jsSi1623 IV. Show Description
jsSi1623 [loxP::mex-5p::PhiC31::sl2::mNG::glh-2 3’ FRT3] IV. Maintain by picking WT GFP+. Heterozygotes are WT GFP+ and segregate WT GFP+, dead eggs (mnDf61 homozygotes) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Heterozygous balancer stock for attB II marked with myo-2p::GFP. Transgene expresses phiC31 and mNG in the germline, facilitates integration of extrachromosomal arrays at high efficiency. References: Nonet ML. bioRxiv 2024.03.01.583017. Rich MS, et al. bioRxiv. 2025 Nov 12:2025.11.11.687718. doi: 10.1101/2025.11.11.687718. PMID: 41293020. |
|
| ESC794 |
C. elegans |
wrdSi23 cse772 [AID*::GFP::rpoa-2] I; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N terminus of endogenous rpoa-2 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530. |
|
| ESC796 |
C. elegans |
wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530. |
|
| ESC797 |
C. elegans |
wrdSi23 I; grwd-1(cse431[grwd-1::AID*::GFP]) III; nucl-1(cse770[nucl-1::mKate2]) IV. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530. |
|