More Fields
Strain Species Genotype
AH5059 C. elegans let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. Show Description
CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted).
CFJ108 C. elegans kstSi60 II; unc-119(ed3) III. Show Description
kstSi60 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] II. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
CFJ111 C. elegans kstSi61 II; unc-119(ed3) III. Show Description
kstSi61 [LoxP + Cbr-unc-119(+) + LoxP + hygroR(kst31)] II. N2-like, no hygromycin resistance (HygroR). hygroR(kst31) is a partial, non-functional hygromycin-resistance construct used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
CFJ184 C. elegans kstSi84 I; unc-119(ed3) III. Show Description
kstSi84 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] I. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
CGC58 C. elegans C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC59 C.elegans gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC61 C. elegans F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC72 C. elegans npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC73 C. elegans npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC78 C. elegans C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC81 C. elegans C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CZ24092 C. elegans gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
CZ25013 C. elegans unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
DG3929 C. elegans tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Show Description
tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Reference: Huelgas-Morales G., et al. G3 (Bethesda). 2016 Apr 7;6(4):1031-47.
DLW109 C. elegans wrdSi23 I; unc-104(knu973[unc-104::AID]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
DLW110 C. elegans wrdSi23 I; unc-18(knu969[unc-18::AID]) X. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
DLW124 C. elegans wrdSi22 I; unc-52(knu968[AID::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
DQM104 C. elegans bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.
DQM1051 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1059 C. elegans bmdSi245 I; hda-1(bmd134[hda-1::GFP::loxP]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM1066 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1068 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1070 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DQM1072 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DQM1126 C. elegans icbSi228 II; unc-119(ed3) III; had-1(bmd134[had-1::GFP::loxP]) V. Show Description
icbSi228 [ttTi5605_right::wrt-2p::wcherry::Dam:linker:egl-13NLS:vhhGFP4::unc-54::unc1193'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.
DQM1285 C. elegans bmdSi363 I; egl-43(bmd88[egl-43p::egl-43::LoxP::GFP::egl-43]) II. Show Description
bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM300 C. elegans egl-43(bmd88[LoxP::gfp::egl-43]) II. Show Description
GFP reporter inserted internally into endogenous egl-43 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
DQM311 C. elegans hlh-2(bmd90[LoxP::GFP::hlh-2]) I. Show Description
GFP reporter inserted into N-terminus of endogenous hlh-2 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
DQM455 C. elegans cki-1(bmd132[GFP::LoxP::cki-1::3xFLAG]) II. Show Description
CRISPR/Cas9 insertion of GFP into the N-terminus of cki-1; seems to cause cki-1 gain-of-function phenotype (early cell cycle exit for some post-embryonic blast cells). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888
DQM494 C. elegans egl-43(bmd136[LoxP::gfp::egl-43(long)]) II. Show Description
GFP reporter inserted into N-terminus of endogenous egl-43 locus specifically tags the long isoform. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
DQM497 C. elegans fos-1(bmd138[LoxP::gfp::fos-1]) V. Show Description
GFP reporter inserted into N-terminus of endogenous fos-1 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
DQM935 C. elegans bmdSi245 I; fos-1(bmd138[fos-1p::LoxP::GFP::fos-1]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Pick Rollers to maintain. Wild-type growth. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DQM973 C. elegans bmdSi245 I; swsn-4(bmd63[LoxP::GFP::swsn-4]) IV. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
DWP219 C. elegans daam-1(ups39) V. Show Description
Superficially wild-type. ups39 is a CRISPR-engineered deletion within daam-1. daam-1(ups39) encodes an in-frame stop codon near the start of its FH2-coding sequence, and a 1-nt frame shift due to the LoxP site, and is thus predicted encode a non-functional formin. Reference: Sundaramurthy S, et al. Cytoskeleton (Hoboken). 2020 Oct;77(10):422-441. doi: 10.1002/cm.21639. PMID: 33103378.
FDU1056 C. elegans mig-17(shc19[mig-17::mNG +LoxP]) V. Show Description
C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430
FGP29 C. elegans gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ieSi38 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
FGP30 C. elegans gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ltIs37 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
FT1523 C. elegans sec-5(xn51[sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II; unc-119(ed3) III. Show Description
sec-5(xn51 [sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II. Knock-in of zf1::yfp and unc-119(+) into the sec-5 locus. Expresses SEC-5::ZF1::YFP maternally and zygotically. Expression in many cells, including early embryos, epithelial cells, excretory cell, and germ line. unc-119 is present in reverse orientation within an intron of YFP. Reference: Armenti ST, et al. Development 2014 (in press).
GN675 C. elegans tba-1(pg77[tba-1::TagRFP-T + loxP]) I; uIs31 III. Show Description
uIs31 [mec-17p::GFP] III. pg77[tba-1::TagRFP-T + loxP] is a CRISPR-mediated c-external tag in the endogenous tba-2 locus. Reference: Lockhead D. et al Mol Biol Cell. 2016 Nov 15; 27(23): 3717–3728.
GN683 C. elegans tbb-1(pg79[tbb-1::TagRFP-T + loxP]) uIs31 III. Show Description
uIs31 [mec-17p::GFP] III. pg79[TBB-1::TagRFP-T + loxP] is a CRISPR-mediated c-external tag in the endogenous tba-2 locus. Reference: Lockhead D. et al Mol Biol Cell. 2016 Nov 15; 27(23): 3717–3728.
GN688 C. elegans tba-2(pg81[tba-2::tagRFP-T + loxP]) I; uIs31 III Show Description
uIs31 [mec-17p::GFP] III. pg81[TBA-2::tagRFP-T + loxP] is a CRISPR-mediated c-external tag in the endogenous tba-2 locus. Reference: Lockhead D. et al Mol Biol Cell. 2016 Nov 15; 27(23): 3717–3728.
GT332 C. elegans aSi10 II; unc-119(ed3) III. Show Description
aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: Paper accepted at eLife.
GT337 C. elegans aSi13 II; unc-119(ed3) III. Show Description
aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST]?II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: Paper accepted at eLife.
HS3750 C. elegans ieSi58 IV; osIs182 V. Show Description
ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::AtTIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
JDW182 C. elegans bmdSi15 lmn-1(wrd39[lmn-1::1xGFP11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.
JDW313 C. elegans jsSi1579; wrdSi58 II. Show Description
wrdSi58 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140
JDW324 C. elegans jsSi1579; wrdSi57 II. Show Description
wrdSi57 [^SEC^eft-3p:TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140
KG4731 C. elegans unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III. Show Description
Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
LP162 C. elegans nmy-2(cp13[nmy-2::GFP + LoxP]) I. Show Description
cp13[nmy-2::gfp + LoxP] I. GFP inserted into the endogenous nmy-2 gene by Cas9-triggered homologous recombination. Green fluorescence in many tissues, especially the germline. Fluorescence is similar to, but brighter than, the nmy-2::GFP transgene zuIs45. Reference: Dickinson DJ, et al. 2013 Nature Methods Advance Online Publication. DOI: 10.1038/nmeth.2641.
LP172 C. elegans hmr-1(cp21[hmr-1::GFP + LoxP]) I. Show Description
cp21[hmr-1::GFP + LoxP] I. GFP inserted at the C terminus of endogenous hmr-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.