RB2127 |
C. elegans |
plk-3(ok2812) IV. Show Description
F55G1.8 Homozygous. Outer Left Sequence: gtaggacggcatggagagtc. Outer Right Sequence: tcacgcatttgaggtggata. Inner Left Sequence: catagacgacatgctcctgg. Inner Right Sequence: ttcttctcttcgggtctcca. Inner Primer PCR Length: 1307. Deletion size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2674 |
C. elegans |
plk-3(gk1103) IV. Show Description
F55G1.8. External left primer: ACGTCACACGATCTGCACTC. External right primer: ACCGCCAATTATCTACGACG. Internal left primer: TGTTTCTGATATCGTGGCGA. Internal right primer: TACACAATCCAAGTTGCCGA. Internal WT amplicon: 2311 bp. Deletion size: 1122 bp. Deletion left flank: TAAAGATCGAATTATTCACAGATTAGTTGT. Deletion right flank: ATATGTTGGCTCAATCGTAGTCTTGAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
AUM1811 |
C. elegans |
plk-3(viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. Expressed primarily in both male and hermaphrodite gonad. Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|
AUM1880 |
C. elegans |
prg-1(viz142[V5::mCherry::GSIGSLRSI::prg-1]) I; plk-3(viz172[plk-3 delta 21u-10935] viz156[plk-3::GGSGGGSGGGSG::GFP]) IV. Show Description
viz172 is a series of point mutations at that piRNA binding site in endogenously-tagged plk-3 locus. GFP tag with linker sequence inserted at C-terminus of endogenous plk-3 locus. V5 epitope and mCherry tags with a flexible linker inserted after the first 18 nt of the coding sequence of endogneous prg-1 locus. Both tagged transgenes are primarily expressed and localized in both hermaphrodite and male gonad. Eight silent mutations in 21u-10935 binding site. Original plk-3: CTCAGTCGTATCGAATATGCCCAA viz172: CTgtccCGTATCGAgTAcGCaCAg Reference: Ortega J, et al. Sci. Adv.10,eadp0466(2024).DOI:10.1126/sciadv.adp0466 https://www.science.org/doi/10.1126/sciadv.adp0466 PMID: 39356768.
|
|