More Fields
Strain Species Genotype
JH3176 C. elegans gtbp-1(ax2029) IV. Show Description
Deletion/insertion (AGCTAGC) of a STOP codon/frameshift near the ATG between IV: 10128909...10128934. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3182 C. elegans gtbp-1(ax2035[gtbp-1::TetraCys]) IV. Show Description
Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3184 C. elegans gtbp-1(ax2037([gtbp-1::Myc]) IV. Show Description
Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3186 C. elegans gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3197 C. elegans gtbp-1(ax2053[gtbp-1::GFP]) IV. Show Description
Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3199 C. elegans gtbp-1(ax2055[gtbp-1::GFP]) IV. Show Description
Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3212 C. elegans gtbp-1(ax2068) IV. Show Description
1.6kb deletion in gtbp-1 between IV: 10127256...10128923. Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3215 C. elegans gtbp-1(ax2073) IV. Show Description
1.6kb deletion in gtbp-1 between IV: 10127264...10128913 and insertion of NheI restriction site (GCTAGC). Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3308 C elegans gtbp-1(ax5000[gtbp-1::tagRFP]) IV. Show Description
tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.
JH4012 C. elegans gtbp-1(ax4561[gtbp-1p::IBB domain::mNeonGreen::gtbp-1 3'utr]) IV. Show Description
The Importin Beta Binding domain (IBB)::mNeonGreen reporter replaces gtbp-1 in the endogenous gtbp-1 locus. Sterile at 25C; maintain at 20C. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans