JH3176 |
C. elegans |
gtbp-1(ax2029) IV. Show Description
Deletion/insertion (AGCTAGC) of a STOP codon/frameshift near the ATG between IV: 10128909...10128934. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH3182 |
C. elegans |
gtbp-1(ax2035[gtbp-1::TetraCys]) IV. Show Description
Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH3184 |
C. elegans |
gtbp-1(ax2037([gtbp-1::Myc]) IV. Show Description
Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH3186 |
C. elegans |
gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH3197 |
C. elegans |
gtbp-1(ax2053[gtbp-1::GFP]) IV. Show Description
Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH3199 |
C. elegans |
gtbp-1(ax2055[gtbp-1::GFP]) IV. Show Description
Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH3212 |
C. elegans |
gtbp-1(ax2068) IV. Show Description
1.6kb deletion in gtbp-1 between IV: 10127256...10128923. Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|
JH3215 |
C. elegans |
gtbp-1(ax2073) IV. Show Description
1.6kb deletion in gtbp-1 between IV: 10127264...10128913 and insertion of NheI restriction site (GCTAGC). Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
|
|