More Fields
Strain Species Genotype
AD294 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
BN1023 C. elegans bqSi294 II; bqSi1021 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1021 [lin-31p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in P1.p-P11.p and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in P1.p-P11.p can mask GFP::HIS-58 signal. May carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN1029 C. elegans bqSi294 II; bqSi1027 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi1027 [unc-122p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in coelomocytes and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in coelomocytes can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN1204 C. elegans bqSi294 II; bqSi1201 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi1201 [hlh-12p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the distal tip cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the distal tip cells can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN617 C. elegans bqSi294 II; bqSi614 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi614 [dat-1p::FLP D5::SL2::mNG + unc-119(+)] IV. Heat shock produces green nuclei in dopaminergic neurons and red nuclei elsewhere. Constitutive expression of diffusible mNeonGreen in dopaminergic neurons can mask GFP::HIS-58 signal.
BN711 C. elegans unc-119(ed3) III; bqSi711 IV. Show Description
bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Constitutive co-expression of codon-optimised FLP and fluorescent mNeonGreen in the germ line. Reference: Macias-Leon J & Askjaer P. (2018): Efficient FLP-mediated germ-line recombination in C. elegans. Micropublication:biology. Dataset. https://doi.org/10.17912/W2G66S
BN854 C. elegans bqSi294 II; bqSi852 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II. bqSi852 [ckb-3p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in the somatic gonad and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in the somatic gonad can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
BN908 C. elegans unc-119(ed9) III; bqSi908 IV. Show Description
bqSi908 [UAS::FLP::SL2::mNG + unc-119(+)] IV. Strain for inducible co-expression of codon-optimised FLP recombinase and fluorescent mNeonGreen by cGAL (GAL4 optimised for C. elegans). Reference: Ayuso C & Askjaer P. Spatiotemporal control of genome recombination through combined FLP-Frt and GAL4-UAS technologies. microPublication Biology. https://doi.org/10.17912/MICROPUB.BIOLOGY.000089.
BN999 C. elegans bqSi294 II; bqSi997 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi997 [nhx-2p::FLP::SL2::mNG + unc-119(+)] IV. Heat shock induces nuclear GFP expression in intestinal cells and nuclear mCherry expression elsewhere. Constitutive expression of diffusible mNeonGreen in intestinal cells can mask GFP::HIS-58 signal. Might carry unc-119(ed3) or unc-119(ed9) III. Reference: Fragoso-Luna A, et al. 2021 bioRxiv 2021.12.21.473632; doi: https://doi.org/10.1101/2021.12.21.473632
DG4228 C. elegans orc-1(tn1732[mNeonGreen::3xflag::orc-1]) III. Show Description
Superficially wild type
DV3208 C. elegans daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
DV3285 C. elegans his-72(cp76[mNeonGreen::3xFlag::his-72]) mpk-1(re172[mpk-1::mKate2::3xFlag]) III. Show Description
Green nuclei and ubiquitous cytosolic red expression, typically excluded from nuclei but with activity-dependent translocation into nuclei. Derived in an N2 background. C-terminally tagged mpk-1 is detectable by triplex PCR: mpk-1 genotyping FW: ACCAAAACAACCATGGGCTCG mpk-1 genotyping RV-1: GCTCCAAGTATGGGTGAGCC mpk-1 genotyping RV-2: GGTTCCCTCGTATGGCTTTCC Reference: Neal R, et al. (2021). Nuclear translocation of tagged endogenous ERK/MPK-1 MAP Kinase denotes a subset of activation events in C. elegans development.
DV3312 C. elegans rgl-1(re179[mNeonGreen::3xFlag::rgl-1]) X. Show Description
Ubiquitous expression with cytosolic localization. Derived in an N2 background. Detection with triplex primers: HS125 5’-CTTGTCACTGTAAGGGAAGATTTCC-3’ HS126 5’-TTGTCCTCCTCTCCCTTGG-3’ HS127 5’ ACGTAGAATGTTCCAGAGTTCCAG-3' Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3327 C. elegans pmk-1(re170[pmk-1::mNG::3xFlag]) IV. Show Description
mNeonGreen and 3xFlag tag inserted at 3' end of endogenous pmk-1 locus. Fluorescent green signal detected in both cytosol and nuclei of all somatic cells; might be silenced in the germ line. Generated in an N2 background. Reference: Shin H, et al. Cell Rep. 2018 Sep 4;24(10):2669-2681. PMID: 30184501
DV3525 C. elegans daf-15(re257[daf-15::mNG::AID]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.
FDU1056 C. elegans mig-17(shc19[mig-17::mNG +LoxP]) V. Show Description
C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430
GLW16 C. elegans rab-7(utx12[mNG::rab-7]) II. Show Description
Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3'
GLW19 C. elegans mpk-1(utx14[mNG::mpk-1]) III. Show Description
Superficially wild-type. N-terminal tag of MPK-1 via CRISPR/Cas9 knock-in of mNeonGreen at mpk-1 locus. Insertion verified by PCR. Left flank: 5' tagaaatttaaaattcatttcttcttgcag 3'; Right flank: 5' ATGGCCGACGGAGAAGCGGTTATCTCGACG 3'. sgRNA: 5' ttcttcttgcagATGGCCGA 3'
GLW2 C. elegans attf-2(utx2[mNG::attf-2]) V. Show Description
Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW33 C. elegans T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW35 C. elegans T13C2.6(utx27[mNG::3xFlag::T13C2.6]) II. Show Description
N-terminal tag of T13C2.6 via CRISPR/Cas9 knock-in of mNeonGreen at T13C2.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' aaatattaattgataatcagaggagtaaaa 3'; Right flank: 5' ATGAGGACATGTCTCACCCTCACGGGTTTC 3'; sgRNA: taatcagaggagtaaaaATG; Cas9/sgRNA plasmid: pGLOW45; mNG^SEC^3xFlag plasmid: pGLOW54; SEC insertion allele strain: GLW34.
GLW39 C. elegans ccdc-47(utx31[mNG::3xFlag::ccdc-47]) III. Show Description
N-terminal tag of CCDC-47 via CRISPR/Cas9 knock-in of mNeonGreen at ccdc-47 locus. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' gttaaatcactcaatttcgggtcgttcacc 3'; Right flank: 5' ATGAAGATAGTATGGATTTTCCTAATATTC 3' (3 silent mutations); sgRNA: cgttcaccATGAAAATCGTC; Cas9/sgRNA plasmid: pGLOW13; mNG^SEC^3xFlag plasmid: pGLOW17; SEC insertion allele strain (balanced): GLW38.
GLW4 C. elegans gyf-1(utx4[gyf-1::mNG]) II. Show Description
Superficially wild-type. C-terminal tag of GYF-1 via CRISPR/Cas9 knock-in of mNeonGreen at gyf-1 locus. Insertion verified by PCR. Left flank: 5' CCATCGGCTCCGGTGAATCCTTCGCGCCGT 3'; Right flank: 5' TAGatgagtcatttctttttccagctttaa 3'. sgRNA: 5' TGACTCATCTAACGGCGCGA 3'
GLW41 C. elegans nhr-8(utx33[mNG::3xFlag::nhr-8]) IV. Show Description
N-terminal tag of NHR-8 via CRISPR/Cas9 knock-in of mNeonGreen at nhr-8 locus. Insertion verified by PCR and Sanger sequencing. Left flank: 5' taatcactaaaacaaaaatttcgtcattcc 3'; Right flank: 5' ATGCCTTCGTCTTCTCCATCGATGGACGAG 3'; sgRNA: CGATGGAGAAGACGAAGGCA; Cas9/sgRNA plasmid: pGLOW55; mNG^SEC^3xFlag plasmid: pGLOW56; SEC insertion allele strain: GLW40.
GLW43 C. elegans edc-3(utx35[mNG::3xFlag::edc-3]) I. Show Description
N-terminal tag of EDC-3 via CRISPR/Cas9 knock-in of mNeonGreen at edc-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' ggttccaattcttctgatttcaaattaaaa 3'; Right flank: 5' ATGGATGACAAACTCATTGGAAGCGTCATCTCTACGGAGACAAAGGACGG 3' (7 silent mutations); sgRNA: ATATCAACCGAAACTAAAGA; Cas9/sgRNA plasmid: pGLOW81; mNG^SEC^3xFlag plasmid: pGLOW103; SEC insertion allele strain: GLW42.
GLW45 C. elegans ZK1058.9(utx37[ZK1058.9::mNG::3xFlag]) III Show Description
C-terminal tag of ZK1058.9 via CRISPR/Cas9 knock-in of mNeonGreen at ZK1058.9 locus. Insertion verified by PCR and fluorescence. Left flank: 5' AGCTCAACGGCTAGCTGGTCTCGTTATTAT 3' (1 silent mutation); Right flank: 5' TAAtgaattttcctccaacttttgtcctct 3'; sgRNA: AATAACGAGACCAGCTAG (18 bp); Cas9/sgRNA plasmid: pGLOW58; mNG^SEC^3xFlag plasmid: pGLOW68; SEC insertion allele strain: GLW44.
GLW47 C. elegans hsp-4(utx39[hsp-4::mNG::3xFlag]) II. Show Description
C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46.
GLW51 C. elegans cey-1(utx43[mNG::3xFlag::cey-1]) II. Show Description
N-terminal tag of CEY-1 via CRISPR/Cas9 knock-in of mNeonGreen at cey-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' accagaggaagaacagaagcgcgcggaaca 3'; Right flank: 5' ATGGCGGAGAAAAACgtaagtgtgtgtctc 3' (1 silent mutation); sgRNA: acacacacttacGTTTTTCT; Cas9/sgRNA plasmid: pGLOW71; mNG^SEC^3xFlag plasmid: pGLOW93; SEC insertion allele strain (balanced): GLW50.
GLW57 C. elegans asp-3(utx47[mNG::3xFlag::asp-3]) X. Show Description
N-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.
GLW6 C. elegans W08E12.7(utx6[mNG::W08E12.7]) IV. Show Description
Superficially wild-type. N-terminal tag of W08E12.7 via CRISPR/Cas9 knock-in of mNeonGreen at W08E12.7 locus. Insertion verified by PCR. Left flank: 5' ttcaatgtttattctttcagatagatcaaa 3'; Right flank: 5' ATGGTTAGAAAGGACAGTGAGAGTAGTTGTTCAAGTGATGG 3' (6 silent mutations). sgRNA: 5' GAAAGCAGCTGCTCCAGCGA 3'
GLW63 C. elegans pqn-59(utx51[mNG::3xFlag::pqn-59]) I. Show Description
N-terminal tag of PQN-59 via CRISPR/Cas9 knock-in of mNeonGreen at pqn-59 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gaccctttttatttataatttgttttcaga 3'; Right flank: 5' ATGGGTATTAAAGGCGACAAAAAAGCTACT 3’ (1 silent mutation); sgRNA: TGCAAGTCGCGCTTGATCGC; Cas9/sgRNA plasmid: pGLOW23; mNG^SEC^3xFlag plasmid: pGLOW24; SEC insertion allele strain (balanced): GLW62.
GLW8 C. elegans eel-1(utx8[mNG::eel-1]) IV. Show Description
Slow growing. N-terminal tag of EEL-1 via CRISPR/Cas9 knock-in of mNeonGreen at eel-1 locus. Insertion verified by PCR. Left flank: 5' gacaagcgggttttttgaatcgtttcgaaa 3'; Right flank: 5' ATGAAGATTGACGATGCTGAGCCGAGCTCTAGTTCATCGGGCTCCGATAT 3' (6 silent mutations). sgRNA: 5' GACCCGGAAGAGCTTGAACT 3'
KRA345 C. elegans cfi-1(kas16[mNG::AID::cfi-1]) I. Show Description
mNeonGreen and AID tags inserted into endogenous cfi-1 locus. Transgene can be degraded in a background expressing TIR1 co-factor supplemented with auxin. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
KRA467 C. elegans lin-39(kas9[lin-39::mNG::AID]) III. Show Description
mNeonGreen::3xFLAG::AID was inserted at the C-terminus of the endogenous lin-39 locus by CRISPR. Endogenous lin-39 expression marked by mNG. LIN-39 protein can be degraded by Auxin application with expression of TIR-1 protein. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
LP212 C. elegans pkc-3(cp41[mNeonGreen:3xFlag::pkc-3 + LoxP]) II. Show Description
mNG::aPKC endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP216 C. elegans par-6(cp45[par-6::mNeonGreen::3xFlag + LoxP unc-119(+) LoxP]) I; unc-119(ed3) III. Show Description
PAR-6::mNG endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP228 C. elegans dsh-2(cp51[mNeonGreen::dsh-2]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP242 C. elegans par-3(cp54[mNeonGreen::3xFlag::par-3]) III. Show Description
mNG::PAR-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
MDX44 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
MLC1480 C. elegans lucIs39. Show Description
lucIs39 [tbx-37p::mNeonGreen::2xNLS::tbx-37 3'UTR + pal-1p::mScarlet-I::2xNLS::tbb-2 3'UTR + med-2p::mScarlet-I::2xNLS::tbb-2 3'UTR]. Wild-type morphology. Integrated array allows for labeling and sorting of ABa and ABp descendants by FACS. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MQD1661 C. elegans daf-2(hq61[daf-2::mNeongreen]) III. Show Description
mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. Phenotypic assays have shown that this mNeonGreen tag does not perturb the function of the DAF-2 protein. DAF-2::mNeonGreen is expressed in neurons, XXX cells, vulval cells, germ cells, and oocytes with clear plasma membrane localization as expected for a cell surface receptor. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD1779 C. elegans daf-2(hq63[daf-2::ICR::NLS::gfp::mNeonGreen::NLS]) III. Show Description
Nuclear Ultrabright GFP::mNeonGreen Fluorescent protein (NuGFP) tag inserted downstream of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. NuGFP cassette is composed of an intercistronic region (ICR) from the C. elegans SL2-type operon, a SV40 nuclear localization sequence (NLS), the coding sequence of GFP, the coding sequence of mNeonGreen, and egl-13 NLS. The expression of NuGFP is tied to that of the endogenous daf-2, but after trans-splicing, the NuGFP protein is synthesized independently of DAF-2. This high-sensitivity daf-2 expression reporter was readily detectable in most C. elegans cells throughout development and adulthood. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2356 C. elegans hqSi8 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3’UTR+Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2374 C. elegans ieSi61 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2375 C. elegans daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.
MQD2378 C. elegans hqSi9 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3’UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis. hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2379 C. elegans hqSi10 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi10 [myo-3p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi10 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the myo-3 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the body wall muscles. hqSi10 previously known as hq375. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2383 C. elegans hqSi11 II; daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi11 [lim-7p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi11 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the lim-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the gonadal sheath. hqSi11 previously known as hq378. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2402 C. elegans daf-2(hq363[daf-2::degron::mNeonGreen]) unc-119(ed3) III; hqSi12 IV. Show Description
hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.