Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC514 C. elegans mir-35(gk262) II. Show Description
Y62F5A.2, Y62F5A.9. Variable DpyEgl phenotype. Most animals are slightly Dpy and slightly Egl. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MCJ11 C. elegans mir-35(cdb2 cdb4) II. Show Description
Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ13 C. elegans mir-35(cdb2 cdb6) II. Show Description
The seed region of the mature mir-35 is replaced with random nucleotides in mir-35(cdb2 cdb6). This mutant mir-35 has little impact on embryonic mir-35 abundance but strongly inhibits its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ180 C elegans mir-35(cdb2 cdb72) II. Show Description
cdb2 cdb72 is a mutation to the 3' end of the mature mir-35 creating a 3’ end containing nucleotides that are not present or rare among all mir-35 family members at a given position, while preserving overall GC content. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ191 C elegans mir-35(cdb2 cdb78) II. Show Description
cdb2 cdb78 is a mutation to the 3' end of the mature mir-35 creating a mutant with mir-35 seed sequence and mir-82 3’ end. This mir-35 mutant strongly impacts embryonic abundance of mir-35 but does not affect its decay at embryo to L1. Superficially wild-type. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ213 C. elegans egl-1(cdb97) V. Show Description
Brood size slightly reduced at 25 degrees. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ217 C. elegans mir-35(cdb2 cdb4) II; egl-1(cdb97) V. Show Description
Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MCJ219 C elegans sup-26(cdb99) nhl-2(cdb100) III; egl-1(cdb97) V. Show Description
nhl-2(cdb100) contains engineered mutations in the mir-35 binding site in the nhl-2 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the egl-1 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Slightly reduced brood size at 25C. Reference: Donnelly BF, et al. (2022). Cell Reports.
MCJ259 C. elegans cex-2(cdb130) mir-35(cdb2 cdb4) II; T28D6.4(cdb133) unc-49(cdb134) IV; egl-1(cdb97) V. Show Description
Superficially wild-type. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039
MLC1016 C. elegans nDf50 nDf49 II; lucIs20. Show Description
lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. Position of integrated transgene unknown (not on X). mir-35 family mutant expressing a mirtron-version of mir-35. nDf50 nDf49 mutants are partially rescued by expression of mirtron-35 from integrated transgene; mild mir-35-related phenotypes are more severe at elevated temperatures. Strain is derived from injection into parental strain MT14533. Position of integrated transgene unknown (not on X). Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
MLC1729 C. elegans drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MT14119 C. elegans nDf50 II. Show Description
Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT14751 C. elegans nDf50 nDf49 II; nEx1187. Show Description
nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT14752 C. elegans nDf50 nDf49 II; nEx1188. Show Description
nEx1188 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT14753 C. elegans nDf50 nDf49 II; nEx1189. Show Description
nEx1189 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
VL413 C. elegans unc-119(ed3) III; wwIs8. Show Description
wwIs8 [mir-35-41p::GFP + unc-119(+)]. Wild-type.
VT3042 C. elegans nDf50 II; her-1(n695) V; nEx1187. Show Description
nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Pick GFP+ to maintain. Segregates GFP+ Egl animals carrying nEx1187 (mir-35 rescuing array) and GFP- animals that develop as XX pseudomales. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
VT3077 C. elegans nDf50/mIn1 [mIs14 dpy-10(e128)] II; sup-26(n1091) III; her-1(n695) V. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
VT3363 C. elegans nDf50/mIn1 [mIs14 dpy-10(e128)] II; nhl-2(ok818) III; her-1(n695) V. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
CGC132 C. elegans mir-356(umn42[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) III. Show Description
mir-356 pre-miRNA deletion strain deletion allele in which mir-356 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CGC142 C. elegans mir-359(umn49[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-359 pre-miRNA deletion allele in which mir-359 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
MT14673 C. elegans mir-359(n4540) X. Show Description
Deletion breakpoints are: TGTTTTATAGAAAGCTGAGGGTGTGTGTGTGTG / CCAGATGG_GTAAGTGAATT / GTTTTGTGTAGATGGTGGAAATGAGCAGGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15019 C. elegans nDf60 V. Show Description
mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16316 C. elegans mir-355(n4618) II. Show Description
Deletion breakpoints are:TGTGTCTATGAAATTAATTC / TTATATCAACTCTAATTAT...TTTTGGGAAAATGAAC / GATTAAACATTTTTTTTA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VL419 C. elegans unc-119(ed3) III; wwEx24. Show Description
wwEx24 [mir-355p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL429 C. elegans unc-119(ed3) III; wwEx25. Show Description
wwEx25 [mir-359p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VT1380 C. elegans unc-119(ed3) III; maIs163. Show Description
maIs163 [mir-357-358p::GFP + unc-119(+)]. Wild type. [10/01/2018: Received new stock from VT following report from user that GFP expression pattern in original stock was not as expected.]