More Fields
Strain Species Genotype
EU2697 C. elegans mei-1(or1178) I; ojIs1; itIs37. Show Description
ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.
HR75 C. elegans mei-1(b284) unc-29(e1072)/mei-1(ct46) unc-13(e1091) I. Show Description
Heterozygotes are WT. ct46 is a dominant, temperature sensitive maternal effect lethal. ct46 homozygotes are viable and fertile at 15C. b284 is a non-conditional, recessive maternal effect lethal. Heterozygotes give more viable progeny at 15C than 25C.
MAS94 C. elegans mei-1(ct46) unc-13(e1091) I; unc-119(ed3) III; abcIs3. Show Description
abcIs3 [pie-1p::ebp-2::GFP + unc-119(+)]. Embryonic-lethal at 25ÂșC due to dominant gain-of-function mutation mei-1(ct46), and Uncoordinated due to unc-13 mutation. Maternal expression of EBP-2::GFP microtubule end-binding protein. EBP-2 encodes an EB1-like protein (end-binding) that, in early embryos, locates to the growing tips of microtubules. A strong fluorescent signal localizes to the centrosomes of early embryos due to a high concentration of polymerizing microtubules. mei-1(ct46)-based ectopic microtubule severing causes mitotic spindle defects in the early embryo. References: Gusnowski EM, Srayko M. J Cell Biol. 2011 Aug 8;194(3):377-86. Tegha-Dunghu J, et al. Methods Mol Biol. 2014;1136:103-16.
VC1530 C. elegans mei-1(ok2000) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
EU1065 C. elegans unc-119(ed3) III; orIs1. Show Description
Appears WT. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 20C or above. Below 20C the GFP signal turns off.
EU2866 C. elegans itIs37 IV; orIs1. Show Description
itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 25C to retain transgene fluorescence. Reference: Connolly AA, et al. J Cell Biol. 2015 (In press).
EU626 C. elegans rfl-1(or198) III. Show Description
Temperature sensitive maternal effect letha mutation in F11H8.1 (Nedd8 activating enzyme). Permissive temperature is 15C, restrictive temperature is 25C. Embryos layed at restrictive temperature have spindle-orientation defects due to the mis-localization of MEI-1/MEI-2 to the mitotic spindle. Additionally, ectopic cleavage furrows are initiated during cytokinesis, and cell-cycle delays are apparent during interphase.
JH3011 C. elegans cdc-37(ax2001) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3012 C. elegans plk-1(ax2002) unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3013 C. elegans unc-119(ed3) orIs1 III; mbk-2(dd5ax2004) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3075 C. elegans tat-4(ax2009) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3076 C. elegans unc-119(ed3) such-1(ax2010) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3078 C. elegans apc-1(ax2012) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Formerly known as mat-2. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3080 C. elegans fzy-1(ax2014) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3086 C. elegans emb-30(ax2003) unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3087 C. elegans xpo-2(ax2013) I; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.