| PHX1658 |
C. elegans |
unc-4(syb1658[unc-4::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous unc-4 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896. |
|
| CB120 |
C. elegans |
unc-4(e120) II. Show Description
Uncoordinated. May contain a weak daf-2 mutation (sa875). See Ailion and Thomas in Genetics 165: 127-144 2003. |
|
| CB4330 |
C. elegans |
unc-4(e2309) II. Show Description
Reference: |
|
| NC268 |
C. elegans |
unc-4(wd44) II. Show Description
Unc. Reference: Winnier AR, et al. Genes Dev. 1999 Nov 1;13(21):2774-86. |
|
| VC1453 |
C. elegans |
unc-4(gk668) II. Show Description
F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 1602 bp. Deletion left flank: CGTTTCCGATCCATCGGATGGATTCAGGAG. Deletion right flank: AACTGGGAAATTGGATTTAAAAATTGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC1528 |
C. elegans |
unc-4(gk705) II. Show Description
F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 307 bp. Deletion left flank: TGCAAAGTATTTCACTACAGTTTTACTGTA. Deletion right flank: GCTTAATCCTGCTAGACTTCTACCACAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| EK224 |
C. elegans |
cmIs6 I; unc-4(e120) II. Show Description
cmIs6 [mbk-1::GFP + unc-4(+)]. Reference: Raich WB, et al. Genetics. 2003 Feb;163(2):571-80. doi: 10.1093/genetics/163.2.571. PMID: 12618396. |
|
| GS1692 |
C. elegans |
unc-4(e120) II; arDp2 (II;f). Show Description
Pick non-Uncs to maintain. arDp2 is derived from mnC1, hence carries dpy-10(e128) and possibly unc-52(e444). arDp2 is a free duplication but does not pass at a high frequency. arDp2 is not stable as a balancer. It is prone to recombination; pick non-Unc and check for segregation of unc-4 and WT in progeny. Do not distribute this strain; other labs should request it from the CGC. |
|
| GS3582 |
C. elegans |
unc-4(e120) II; arIs92. Show Description
arIs92[egl-17p::NLS-CFP-LacZ + unc-4(+) + ttx-3::GFP]. Do not distribute this strain; other labs should request it from the CGC. |
|
| GS4249 |
C. elegans |
unc-4(e120) II; arIs82. Show Description
arIs82 [lin-12::GFP + egl-17p::lacZ + unc-4(+)]. Reference: Shaye DD, Greenwald I. Nature. 2002 Dec 12;420(6916):686-90. Do not distribute this strain; other labs should request it from the CGC. |
|
| JK2785 |
C. elegans |
unc-4(e120) II; qIs55. Show Description
qIs55 [hnd-1::GFP + unc-4(+)] integrated on IV or V. Do not distribute this strain; other labs should request it from the CGC. |
|
| OH438 |
C. elegans |
unc-4(e120) II; otIs117 IV. Show Description
otIs117 [unc-33p::GFP + unc-4(+)]. Pan-neuronal GFP. |
|
| PS9357 |
C. briggsae |
Cbr-unc-4(sy5341) II. Show Description
Do not distribute this strain; other labs should request it from the CGC. |
|
| VC10070 |
C. elegans |
K05F1(gk773) unc-4(e120) II. Show Description
K05F1. Unc. External left primer: GTATGGTCCGTCGCAAGAAT. External right primer: CTGATGACGGTTTTCCTGGT. External WT amplicon: 1653 bp. Deletion size: 490 bp. Deletion left flank: CCGCCAAATTTGGCGGTTTCTGAGACCTTG. Deletion right flank: CTCGCATACGCTTGAAACTTACAGCGTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC10073 |
C. elegans |
T28D9(gk776) unc-4(e120) II. Show Description
T28D9. Unc. External left primer: CATTTCGGAACGTTTCCATC. External right primer: TCTGCTTCGTACTTTGCTGC. External WT amplicon: 1121 bp. Deletion size: 436 bp. Deletion left flank: TTTTTTACGTGAATCTTTTTTTTTTCAGAA. Deletion right flank: CAAGTTGTGAATTTTCGAACATCCGTCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC10109 |
C. elegans |
K05F6(gk907) unc-4(e120) II. Show Description
K05F6.2. Unc. External left primer: ACAAATTCCCTTTGTCGTCG. External right primer: TGGATGAGCAGCTGGTAAGA. External WT amplicon: 200 bp. This strain carries a point mutation in K05F6.2. The mutation is gk907, which is a T->A mutation at K05F6 coordinate 21364 (flanking sequences AAATCAAAAACTCTGTTTGATGGATATCTA and ATGCCTTTAAATGATCTACTTCTTACCAGC). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| AG168 |
C. elegans |
fzy-1(av15) unc-4(e120) II. Show Description
Unc. Gain-of-function allele of fzy-1. |
|
| CB3970 |
C. elegans |
unc-4(e120) bli-1(e769) II. Show Description
Uncoordinated and Blistered. |
|
| CB5310 |
C. elegans |
unc-4(e120) II; lon-2(e678)^lon-2(e678) X. Show Description
Attached X strain with autosomal unc-4 marker, which facilitates test-crosses. Uncoordinated Long hermaphrodites, reduced fertility with many X^X X^X unhatched eggs. Reference: Hodgkin & Albertson (1995) PMID: 8647390. |
|
| DR103 |
C. elegans |
dpy-10(e128) unc-4(e120) II. Show Description
DpyUnc. [NOTE: Likely contains background mrt mutation (re47) (D. Reiner). Segregates males, sickly animals, and dark steriles growing progessively worse in subsequent generations. (D. Reiner & S. Ahmed, 2011)] |
|
| DR1720 |
C. elegans |
unc-4(e120) daf-19(m86) II. Show Description
Unc. Dauer constitutive. |
|
| DR518 |
C. elegans |
rol-6(su1006) unc-4(e120) II. Show Description
RollerUnc. |
|
| EW33 |
C. elegans |
unc-4(e120) pvl-4(ga96) II. Show Description
Egl. Pvl. Misshapen larvae (some lethal). Unc. |
|
| GE1708 |
C. elegans |
dpy-2(e8) unc-4(e120) II. Show Description
DpyUnc. |
|
| GE1710 |
C. elegans |
rol-6(e187) unc-4(e120) II. Show Description
Roller Unc. |
|
| LC37 |
C. elegans |
dpy-10(e128) unc-4(e120) II. Show Description
Dpy Unc. Derived from DR103. Outcrossed 3 times. |
|
| MH1829 |
C. elegans |
fzr-1(ku298) unc-4(e120) II. Show Description
Animals are healthy and Unc. Synthetic lethal/hyperproliferation with lin-35. |
|
| MT1502 |
C. elegans |
egl-26(n481) unc-4(e120) II. Show Description
Egl. Abnormal vuvla. |
|
| MT588 |
C. elegans |
lin-31(n301) unc-4(e120) II. Show Description
Muv. Unc. |
|
| NC168 |
C. elegans |
unc-4(e26) II; dpy-20 IV; wdEx60. Show Description
wdEx60 contains [acr-5::GFP + dpy-20(+)]. Maintain by picking non-Dpy. |
|
| NC37 |
C. elegans |
unc-37(wd17) I; unc-4(e2322) II. Show Description
unc-37(wd17) is a dominat suppressor of unc-4(e2322ts). unc-37(wd17) has no phenotype alone. |
|
| OH2225 |
C. elegans |
unc-4(e120) die-1(ot26) II. Show Description
|
|
| PS80 |
C. elegans |
let-23(sy1) unc-4(e120) II. Show Description
Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. |
|
| SP399 |
C. elegans |
dpy-10(sc48)/unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, Uncs and Dpys which are left Rollers. |
|
| SP419 |
C. elegans |
unc-4(e120) rol-1(e91) II. Show Description
|
|
| TJ1047 |
C. elegans |
unc-4(e120) emb-27(g48) II. Show Description
Unc. Temperature sensitive. Maintain at 15C. |
|
| TY2788 |
C. elegans |
unc-4(e120) II; yDf19/yDf20 X. Show Description
yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc. |
|
| VC10068 |
C. elegans |
unc-4(e120) sre-29(gk771) II. Show Description
F57G9.4. Unc. External left primer: GACCTGAAATTGCTGGGAAA. External right primer: GGAAACTCACAAATTGCCGT. External WT amplicon: 1532 bp. Deletion size: 161 bp. Deletion left flank: CCCTCTCCACCGCAATTGCAAGAACTCCAA. Deletion right flank: GCTATAGTAATCAATTTTCCAATTATAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC10071 |
C. elegans |
srb-16(gk774) unc-4(e120) II. Show Description
F58A6.6. Unc. External left primer: AAGTGGTTTTGGGTCTGACG. External right primer: GTACCGCCGCAAGAATGTAT. Internal left primer: GCCGCCACGAGTTAATAGAA. Internal right primer: TGTTGGCCCTGATTTCTTTC. Internal WT amplicon: 4857 bp. Deletion size: 3522 bp. Deletion left flank: ACGATTTTTGCACAAAAAACCCCTCCAAAC. Deletion right flank: GTCGTTTGCTTGTTTCATCTTCATCATTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC10072 |
C. elegans |
cpna-2(gk775) unc-4(e120) II. Show Description
B0228.4. Unc. External left primer: GCTCAAAGCTCCGAAACAAC. External right primer: CCCACAAGATTGGTAAGCGT. External WT amplicon: 876 bp. Deletion size: 153 bp. Deletion left flank: AGTTAGACACACTGAAAATGCTGGAAAGGT. Deletion right flank: CAGAAGCCTTGCTCCGTCGGCATCTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC10075 |
C. elegans |
T05A6.4(gk777) unc-4(e120) II. Show Description
T05A6.4. Unc. External left primer: GCAATCCTTCAAGTTCCCAA. External right primer: ACGACTTGCAGATGGTTGTG. External WT amplicon: 902 bp. Deletion size: 140 bp. Deletion left flank: GGGCATGTAAAAGTGTGCTTGTCTTTCATA. Deletion right flank: TACCACCATTTTTTTTTCATTTTTGGATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC10078 |
C. elegans |
syd-1(gk802) unc-4(e120) II. Show Description
F35D2.5. Unc. External left primer: TCAACGTTGTCGCTGATCTC. External right primer: CCTCAAATTCACGGAATGCT. External WT amplicon: 543 bp. This strain carries a point mutation in F35D2.5. The mutation is gk802, which is an A->T mutation at F35D2 coordinate 23221 (flanking sequences TCGACCAACTCACTAACTCTTGAGGGCCAT and TCGACAAAATCATTTGGAGACTTGAAGATG). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC10079 |
C. elegans |
unc-4(e120) mix-1(gk803) II. Show Description
M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC10110 |
C. elegans |
let-19(gk908) unc-4(e120) II. Show Description
K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| AT28 |
C. elegans |
kyIs140 I; srf-6(yj13) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4). |
|
| AT30 |
C. elegans |
kyIs140 I; nsy-1(ok593) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons. |
|
| CGC53 |
C. elegans |
unc-4(e120)/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2, Unc-4 non-mKate2, and Dpy mKate2+ mIn1 homozygotes. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9. |
|
| PJ821 |
C. elegans |
unc-4(e120) jDf4/unc-4(e120) let-257(mn235) II. Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and UncLets. Lethal in larval development. Also reference 710. |
|
| VC10067 |
C. elegans |
F31D5.1(gk770) gkDf13 unc-4(e120) II. Show Description
This strain is homozygous for two deletions plus unc-4(e120). The deletions were identified by comparative genome hybridization (CGH) of a mutangenized unc-4 line against N2. The deletion gk770 was confirmed by PCR and sequencing of the amplification product, and is detectable using the following primers. Left primer: GCGCATTTGCAACATCTCTA. Right primer: AACCTCAACGGAAACACTGG. WT amplicon: 1087 bp. Deletion size: 142 bp. Deletion left flank: CAGGTGAGCTTAAGCAGATTTTTTTTTGAA. Deletion right flank: GTGAGCCAAGTTAAACATTTGAAAATAATT. Insertion Sequence: GTGAGCCAAGTTGAACATTTGAAAATAAT. The deletion gkDf13 was not confirmed by PCR. CGH data indicates a maximum size of 7801 bp and a minimum size of 1357 bp. Left flanking probe: GTTTTATCTTTCGGCTTATTCAGAATAAATTATTGGTTCAGTTGTTTCAG. Left deleted probe: AGGAGAAGGAGATAAATGGTCTTGTAGACTGCGCAGCTAGGGAGAGAGAA. Right deleted probe: GAAGTTCTGAAGATTCAATTTTCAGTCTTACAATATTCAGTTCTCGTGTA. Right flanking probe: GTTGAATTTATTCGAATTTTGCAATTTCAGCAAAACACCTTTATCTTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|
| VC10077 |
C. elegans |
unc-4(e120) Y46E12BL.2(gk801gk909) II. Show Description
Y46E12BL.2. Unc. External left primer: ATCCACAATGCTCCGATCTC. External right primer: TCTGGCTTGCTTTTGTGATG. External WT amplicon: 540 bp. This strain contains two point mutations in Y46E12BL.2. The first is gk801, which is a G->A mutation at Y46E12BL coordinate 21938 (flanking sequences GTTCTTGAAGCTATACGGCTTTACACAGAA and TTACTCCAGCCGATCTGGTCACCCGTTATG). The second is gk909, which is an A->G mutation at Y46E12BL coordinate 21966 (flanking sequences AAGTTACTCCAGCCGATCTGGTCACCCGTT and TGTCGATAGTGCGATCGCCAAGTCCAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807 |
|