More Fields
Strain Species Genotype
PHX1658 C. elegans unc-4(syb1658[unc-4::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous unc-4 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
CB120 C. elegans unc-4(e120) II. Show Description
Uncoordinated. May contain a weak daf-2 mutation (sa875). See Ailion and Thomas in Genetics 165: 127-144 2003.
CB4330 C. elegans unc-4(e2309) II. Show Description
Reference:
NC268 C. elegans unc-4(wd44) II. Show Description
Unc. Reference: Winnier AR, et al. Genes Dev. 1999 Nov 1;13(21):2774-86.
VC1453 C. elegans unc-4(gk668) II. Show Description
F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 1602 bp. Deletion left flank: CGTTTCCGATCCATCGGATGGATTCAGGAG. Deletion right flank: AACTGGGAAATTGGATTTAAAAATTGAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1528 C. elegans unc-4(gk705) II. Show Description
F26C11.2. Unc. External left primer: TTCATGGTGAGAACGAGCAG. External right primer: GGCATATGTACGAGGCAGGT. Internal left primer: CGCAAGGTGAAATGAGTGAA. Internal right primer: GCCGACACGCCTACTTTCTA. Internal WT amplicon: 2274 bp. Deletion size: 307 bp. Deletion left flank: TGCAAAGTATTTCACTACAGTTTTACTGTA. Deletion right flank: GCTTAATCCTGCTAGACTTCTACCACAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
EK224 C. elegans cmIs6 I; unc-4(e120) II. Show Description
cmIs6 [(pBR104) mbk-1::GFP + pNC4.21].
GS1692 C. elegans unc-4(e120) II; arDp2 (II;f). Show Description
Pick non-Uncs to maintain. arDp2 is derived from mnC1, hence carries dpy-10(e128) and possibly unc-52(e444). arDp2 is a free duplication but does not pass at a high frequency. arDp2 is not stable as a balancer. It is prone to recombination; pick non-Unc and check for segregation of unc-4 and WT in progeny. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS3582 C. elegans unc-4(e120) II; arIs92. Show Description
arIs92[egl-17p::NLS-CFP-LacZ + unc-4(+) + ttx-3::GFP]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
GS4249 C. elegans unc-4(e120) II; arIs82. Show Description
arIs82 [lin-12::GFP + egl-17p::lacZ + unc-4(+)]. Reference: Shaye DD, Greenwald I. Nature. 2002 Dec 12;420(6916):686-90. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK2785 C. elegans unc-4(e120) II; qIs55. Show Description
qIs55 [hnd-1::GFP + unc-4(+)] integrated on IV or V. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
OH438 C. elegans unc-4(e120) II; otIs117 IV. Show Description
otIs117 [unc-33p::GFP + unc-4(+)]. Pan-neuronal GFP.
PS9357 C. briggsae Cbr-unc-4(sy5341) II. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VC10070 C. elegans K05F1(gk773) unc-4(e120) II. Show Description
K05F1. Unc. External left primer: GTATGGTCCGTCGCAAGAAT. External right primer: CTGATGACGGTTTTCCTGGT. External WT amplicon: 1653 bp. Deletion size: 490 bp. Deletion left flank: CCGCCAAATTTGGCGGTTTCTGAGACCTTG. Deletion right flank: CTCGCATACGCTTGAAACTTACAGCGTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10073 C. elegans T28D9(gk776) unc-4(e120) II. Show Description
T28D9. Unc. External left primer: CATTTCGGAACGTTTCCATC. External right primer: TCTGCTTCGTACTTTGCTGC. External WT amplicon: 1121 bp. Deletion size: 436 bp. Deletion left flank: TTTTTTACGTGAATCTTTTTTTTTTCAGAA. Deletion right flank: CAAGTTGTGAATTTTCGAACATCCGTCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10109 C. elegans K05F6(gk907) unc-4(e120) II. Show Description
K05F6.2. Unc. External left primer: ACAAATTCCCTTTGTCGTCG. External right primer: TGGATGAGCAGCTGGTAAGA. External WT amplicon: 200 bp. This strain carries a point mutation in K05F6.2. The mutation is gk907, which is a T->A mutation at K05F6 coordinate 21364 (flanking sequences AAATCAAAAACTCTGTTTGATGGATATCTA and ATGCCTTTAAATGATCTACTTCTTACCAGC). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
AG168 C. elegans fzy-1(av15) unc-4(e120) II. Show Description
Unc. Gain-of-function allele of fzy-1.
CB3970 C. elegans unc-4(e120) bli-1(e769) II. Show Description
Uncoordinated and Blistered.
CB5310 C. elegans unc-4(e120) II; lon-2(e678)^lon-2(e678) X. Show Description
Attached X strain with autosomal unc-4 marker, which facilitates test-crosses. Uncoordinated Long hermaphrodites, reduced fertility with many X^X X^X unhatched eggs. Reference: Hodgkin & Albertson (1995) PMID: 8647390.
DR103 C. elegans dpy-10(e128) unc-4(e120) II. Show Description
DpyUnc. [NOTE: Likely contains background mrt mutation (re47) (D. Reiner). Segregates males, sickly animals, and dark steriles growing progessively worse in subsequent generations. (D. Reiner & S. Ahmed, 2011)]
DR1720 C. elegans unc-4(e120) daf-19(m86) II. Show Description
Unc. Dauer constitutive.
DR518 C. elegans rol-6(su1006) unc-4(e120) II. Show Description
RollerUnc.
EW33 C. elegans unc-4(e120) pvl-4(ga96) II. Show Description
Egl. Pvl. Misshapen larvae (some lethal). Unc.
GE1708 C. elegans dpy-2(e8) unc-4(e120) II. Show Description
DpyUnc.
GE1710 C. elegans rol-6(e187) unc-4(e120) II. Show Description
Roller Unc.
LC37 C. elegans dpy-10(e128) unc-4(e120) II. Show Description
Dpy Unc. Derived from DR103. Outcrossed 3 times.
MH1829 C. elegans fzr-1(ku298) unc-4(e120) II. Show Description
Animals are healthy and Unc. Synthetic lethal/hyperproliferation with lin-35.
MT1502 C. elegans egl-26(n481) unc-4(e120) II. Show Description
Egl. Abnormal vuvla.
MT588 C. elegans lin-31(n301) unc-4(e120) II. Show Description
Muv. Unc.
NC168 C. elegans unc-4(e26) II; dpy-20 IV; wdEx60. Show Description
wdEx60 contains [acr-5::GFP + dpy-20(+)]. Maintain by picking non-Dpy.
NC37 C. elegans unc-37(wd17) I; unc-4(e2322) II. Show Description
unc-37(wd17) is a dominat suppressor of unc-4(e2322ts). unc-37(wd17) has no phenotype alone.
OH2225 C. elegans unc-4(e120) die-1(ot26) II. Show Description
PS80 C. elegans let-23(sy1) unc-4(e120) II. Show Description
Unc. Viable allele of let-23. Vul. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
SP399 C. elegans dpy-10(sc48)/unc-4(e120) II. Show Description
Heterozygotes are WT and segregate WT, Uncs and Dpys which are left Rollers.
SP419 C. elegans unc-4(e120) rol-1(e91) II. Show Description
TJ1047 C. elegans unc-4(e120) emb-27(g48) II. Show Description
Unc. Temperature sensitive. Maintain at 15C.
TY2788 C. elegans unc-4(e120) II; yDf19/yDf20 X. Show Description
yDf20 previously known as y288. Internal deletion. Takes out dpy-3 and lin-32. Heterozygotes are Unc.
VC10068 C. elegans unc-4(e120) sre-29(gk771) II. Show Description
F57G9.4. Unc. External left primer: GACCTGAAATTGCTGGGAAA. External right primer: GGAAACTCACAAATTGCCGT. External WT amplicon: 1532 bp. Deletion size: 161 bp. Deletion left flank: CCCTCTCCACCGCAATTGCAAGAACTCCAA. Deletion right flank: GCTATAGTAATCAATTTTCCAATTATAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10071 C. elegans srb-16(gk774) unc-4(e120) II. Show Description
F58A6.6. Unc. External left primer: AAGTGGTTTTGGGTCTGACG. External right primer: GTACCGCCGCAAGAATGTAT. Internal left primer: GCCGCCACGAGTTAATAGAA. Internal right primer: TGTTGGCCCTGATTTCTTTC. Internal WT amplicon: 4857 bp. Deletion size: 3522 bp. Deletion left flank: ACGATTTTTGCACAAAAAACCCCTCCAAAC. Deletion right flank: GTCGTTTGCTTGTTTCATCTTCATCATTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10072 C. elegans cpna-2(gk775) unc-4(e120) II. Show Description
B0228.4. Unc. External left primer: GCTCAAAGCTCCGAAACAAC. External right primer: CCCACAAGATTGGTAAGCGT. External WT amplicon: 876 bp. Deletion size: 153 bp. Deletion left flank: AGTTAGACACACTGAAAATGCTGGAAAGGT. Deletion right flank: CAGAAGCCTTGCTCCGTCGGCATCTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10075 C. elegans T05A6.4(gk777) unc-4(e120) II. Show Description
T05A6.4. Unc. External left primer: GCAATCCTTCAAGTTCCCAA. External right primer: ACGACTTGCAGATGGTTGTG. External WT amplicon: 902 bp. Deletion size: 140 bp. Deletion left flank: GGGCATGTAAAAGTGTGCTTGTCTTTCATA. Deletion right flank: TACCACCATTTTTTTTTCATTTTTGGATGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10078 C. elegans syd-1(gk802) unc-4(e120) II. Show Description
F35D2.5. Unc. External left primer: TCAACGTTGTCGCTGATCTC. External right primer: CCTCAAATTCACGGAATGCT. External WT amplicon: 543 bp. This strain carries a point mutation in F35D2.5. The mutation is gk802, which is an A->T mutation at F35D2 coordinate 23221 (flanking sequences TCGACCAACTCACTAACTCTTGAGGGCCAT and TCGACAAAATCATTTGGAGACTTGAAGATG). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10079 C. elegans unc-4(e120) mix-1(gk803) II. Show Description
M106.1. Unc. External left primer: GTTGAGGAAGCAGCTGGAAC. External right primer: TTCTTCGCAGCAGTAATCCC. External WT amplicon: 815 bp. This strain carries a point mutation in M106.1. The mutation is gk803, which is an A->G mutation at R06F6 coordinate 40587 (flanking sequences CACAAAATACCGTAATGACCTCGAATCCCT and ACGAGAGGAACAATTGCTAATGACAAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10110 C. elegans let-19(gk908) unc-4(e120) II. Show Description
K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
AT28 C. elegans kyIs140 I; srf-6(yj13) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).
AT30 C. elegans kyIs140 I; nsy-1(ok593) unc-4(e120) II. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons.
CGC53 C. elegans mIn1 [dpy-10(e128) umnIs43]/unc-4(e120) II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2, Unc-4 non-mKate2, and Dpy mKate2+ mIn1 homozygotes. Maintain by picking wild-type mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into mIn1 balancer in parental strain DR1785 using CRISPR/Cas9.
PJ821 C. elegans unc-4(e120) jDf4/unc-4(e120) let-257(mn235) II. Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and UncLets. Lethal in larval development. Also reference 710.
VC10067 C. elegans F31D5.1(gk770) gkDf13 unc-4(e120) II. Show Description
This strain is homozygous for two deletions plus unc-4(e120). The deletions were identified by comparative genome hybridization (CGH) of a mutangenized unc-4 line against N2. The deletion gk770 was confirmed by PCR and sequencing of the amplification product, and is detectable using the following primers. Left primer: GCGCATTTGCAACATCTCTA. Right primer: AACCTCAACGGAAACACTGG. WT amplicon: 1087 bp. Deletion size: 142 bp. Deletion left flank: CAGGTGAGCTTAAGCAGATTTTTTTTTGAA. Deletion right flank: GTGAGCCAAGTTAAACATTTGAAAATAATT. Insertion Sequence: GTGAGCCAAGTTGAACATTTGAAAATAAT. The deletion gkDf13 was not confirmed by PCR. CGH data indicates a maximum size of 7801 bp and a minimum size of 1357 bp. Left flanking probe: GTTTTATCTTTCGGCTTATTCAGAATAAATTATTGGTTCAGTTGTTTCAG. Left deleted probe: AGGAGAAGGAGATAAATGGTCTTGTAGACTGCGCAGCTAGGGAGAGAGAA. Right deleted probe: GAAGTTCTGAAGATTCAATTTTCAGTCTTACAATATTCAGTTCTCGTGTA. Right flanking probe: GTTGAATTTATTCGAATTTTGCAATTTCAGCAAAACACCTTTATCTTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC10077 C. elegans unc-4(e120) Y46E12BL.2(gk801gk909) II. Show Description
Y46E12BL.2. Unc. External left primer: ATCCACAATGCTCCGATCTC. External right primer: TCTGGCTTGCTTTTGTGATG. External WT amplicon: 540 bp. This strain contains two point mutations in Y46E12BL.2. The first is gk801, which is a G->A mutation at Y46E12BL coordinate 21938 (flanking sequences GTTCTTGAAGCTATACGGCTTTACACAGAA and TTACTCCAGCCGATCTGGTCACCCGTTATG). The second is gk909, which is an A->G mutation at Y46E12BL coordinate 21966 (flanking sequences AAGTTACTCCAGCCGATCTGGTCACCCGTT and TGTCGATAGTGCGATCGCCAAGTCCAAGGA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807