AH5059 |
C. elegans |
let-23(zh131[FRT::let-23::FRT::GFP::LoxP::FLAG::let-23]) II. Show Description
CRISPR allele of endogenous let-23, which expresses let-23::GFP fusion protein and is susceptible for conditional knock-out via incorporated FRT sites with FLPase expression. Reference: Konietzka et al. 2019. Current Biology (accepted).
|
|
CFJ108 |
C. elegans |
kstSi60 II; unc-119(ed3) III. Show Description
kstSi60 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] II. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
|
|
CFJ111 |
C. elegans |
kstSi61 II; unc-119(ed3) III. Show Description
kstSi61 [LoxP + Cbr-unc-119(+) + LoxP + hygroR(kst31)] II. N2-like, no hygromycin resistance (HygroR). hygroR(kst31) is a partial, non-functional hygromycin-resistance construct used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
|
|
CFJ184 |
C. elegans |
kstSi84 I; unc-119(ed3) III. Show Description
kstSi84 [LoxP + Cbr-unc-119(+) + LoxP + mlc-2p::GFP(kst32)] I. N2-like, no MLC-2::GFP fluorescence. mlc-2p::GFP(kst32) is a partial, non-functional GFP reporter used for section in MosTI, an updated technique for targeted single-copy and extra-chromosomal array insertion. Cbr-unc-119(+) is flanked by LoxP sites, facilitating removal by recombination. Reference: El Mouridi S, et al. 2022.
|
|
CGC58 |
C. elegans |
C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC59 |
C.elegans |
gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC61 |
C. elegans |
F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC72 |
C. elegans |
npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC73 |
C. elegans |
npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC78 |
C. elegans |
C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CGC81 |
C. elegans |
C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
CZ24092 |
C. elegans |
gip-2(lt19[gip-2::GFP::loxP::Cbr-unc-119(+)::loxP]) I; ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::ZIF-1::operon-linker::mKate2::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP tag inserted into the C-terminus of the endogenous gip-2 locus using CRISPR-Cas9 engineering. Tissue-specific expression of GFP nanobody::ZIF-1 fusion promotes ubiquitylation and subsequent degradation of GFP-tagged gip-2 protein in touch receptor neurons. Touch receptor neurons are red labeled with mKate2. Reference: Development. 2017 Jul 15;144(14):2694-2701. PMID: 28619826.
|
|
CZ25013 |
C. elegans |
unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
|
|
DG3929 |
C. elegans |
tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Show Description
tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Reference: Huelgas-Morales G., et al. G3 (Bethesda). 2016 Apr 7;6(4):1031-47.
|
|
DLW109 |
C. elegans |
wrdSi23 I; unc-104(knu973[unc-104::AID]) II. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-104 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DLW110 |
C. elegans |
wrdSi23 I; unc-18(knu969[unc-18::AID]) X. Show Description
wrdSi23 [eft-3p::TIR1:F2A:mTagBFP:tbb2 3' UTR:: loxP] I. wrdSi23 is inserted at ttTi4348 (I: -5.32 cM). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at C-terminus of endogenous unc-18 locus by CRISPR/Cas9. Can be used for auxin-induced immobilization of worms for live imaging. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DLW124 |
C. elegans |
wrdSi22 I; unc-52(knu968[AID::unc-52]) II. Show Description
wrdSi22 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR::SEC[LoxP + let-858 term + sqt-1(d) + hs::Cre + hygR + unc-54 term + LoxP]] I. wrdSi22 is inserted at ttTi4348 (-5.32 cM). Pick Rollers to maintain animals retaining the SEC in the insertion. SEC can be removed by heat shock-induced excision according to the protocol in Dickinson et. al. Genetics 2015. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Auxin-inducible degradation (AID) tag inserted at N-terminus of endogenous unc-52 locus by CRISPR/Cas9. References: Cahoon CK and Libuda DE. bioRxiv 2021.05.25.445686; doi: https://doi.org/10.1101/2021.05.25.445686. Ashley GE, et al. Genetics. 2021 Mar 31;217(3):iyab006. doi: 10.1093/genetics/iyab006. PMID: 33677541
|
|
DQM1059 |
C. elegans |
bmdSi245 I; hda-1(bmd134[hda-1::GFP::loxP]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Relatively slow growth compared to N2 animals. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
|
|
DQM1126 |
C. elegans |
icbSi228 II; unc-119(ed3) III; had-1(bmd134[had-1::GFP::loxP]) V. Show Description
icbSi228 [ttTi5605_right::wrt-2p::wcherry::Dam:linker:egl-13NLS:vhhGFP4::unc-54::unc1193'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.
|
|
DQM1285 |
C. elegans |
bmdSi363 I; egl-43(bmd88[egl-43p::egl-43::LoxP::GFP::egl-43]) II. Show Description
bmdSi363 [^SEC^ser-2p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
|
|
DQM300 |
C. elegans |
egl-43(bmd88[LoxP::gfp::egl-43]) II. Show Description
GFP reporter inserted internally into endogenous egl-43 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
|
|
DQM311 |
C. elegans |
hlh-2(bmd90[LoxP::GFP::hlh-2]) I. Show Description
GFP reporter inserted into N-terminus of endogenous hlh-2 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
|
|
DQM455 |
C. elegans |
cki-1(bmd132[GFP::LoxP::cki-1::3xFLAG]) II. Show Description
CRISPR/Cas9 insertion of GFP into the N-terminus of cki-1; seems to cause cki-1 gain-of-function phenotype (early cell cycle exit for some post-embryonic blast cells). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888
|
|
DQM494 |
C. elegans |
egl-43(bmd136[LoxP::gfp::egl-43(long)]) II. Show Description
GFP reporter inserted into N-terminus of endogenous egl-43 locus specifically tags the long isoform. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
|
|
DQM497 |
C. elegans |
fos-1(bmd138[LoxP::gfp::fos-1]) V. Show Description
GFP reporter inserted into N-terminus of endogenous fos-1 locus. Reference: Medwig-Kinney TN, et al. Development. 2020 Jan 2;147(1).
|
|
DQM935 |
C. elegans |
bmdSi245 I; fos-1(bmd138[fos-1p::LoxP::GFP::fos-1]) V. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
|
|
DQM973 |
C. elegans |
bmdSi245 I; swsn-4(bmd63[LoxP::GFP::swsn-4]) IV. Show Description
bmdSi245 [^SEC^lin-29p::mKate2-STOP-STOP-DAMc1::VHH4GFP] I. Wild-type growth and movement. NanoDam toolkit will allows identification of direct genomic targets of TFs as well as chromatin modifiers. In this system, Dam methylase is fused with a binding reagent, an anti-GFP nanobody (vhhGFP4). Thus, genome-wide profiling can be achieved by combining cell type-specific Dam::vhhGFP4 fusion constructs with GFP knock-in alleles.
|
|
FDU1056 |
C. elegans |
mig-17(shc19[mig-17::mNG +LoxP]) V. Show Description
C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430
|
|
FGP29 |
C. elegans |
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ieSi38 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
|
|
FGP30 |
C. elegans |
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ltIs37 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
|
|
FT1523 |
C. elegans |
sec-5(xn51[sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II; unc-119(ed3) III. Show Description
sec-5(xn51 [sec-5::zf1::YFP + LoxP::unc-119::LoxP]) II. Knock-in of zf1::yfp and unc-119(+) into the sec-5 locus. Expresses SEC-5::ZF1::YFP maternally and zygotically. Expression in many cells, including early embryos, epithelial cells, excretory cell, and germ line. unc-119 is present in reverse orientation within an intron of YFP. Reference: Armenti ST, et al. Development 2014 (in press).
|
|
GN675 |
C. elegans |
tba-1(pg77[tba-1::TagRFP-T + loxP]) I; uIs31 III. Show Description
uIs31 [mec-17p::GFP] III. pg77[tba-1::TagRFP-T + loxP] is a CRISPR-mediated c-external tag in the endogenous tba-2 locus. Reference: Lockhead D. et al Mol Biol Cell. 2016 Nov 15; 27(23): 37173728.
|
|
GN683 |
C. elegans |
tbb-1(pg79[tbb-1::TagRFP-T + loxP]) uIs31 III. Show Description
uIs31 [mec-17p::GFP] III. pg79[TBB-1::TagRFP-T + loxP] is a CRISPR-mediated c-external tag in the endogenous tba-2 locus. Reference: Lockhead D. et al Mol Biol Cell. 2016 Nov 15; 27(23): 37173728.
|
|
GN688 |
C. elegans |
tba-2(pg81[tba-2::tagRFP-T + loxP]) I; uIs31 III Show Description
uIs31 [mec-17p::GFP] III. pg81[TBA-2::tagRFP-T + loxP] is a CRISPR-mediated c-external tag in the endogenous tba-2 locus. Reference: Lockhead D. et al Mol Biol Cell. 2016 Nov 15; 27(23): 37173728.
|
|
HS3750 |
C. elegans |
ieSi58 IV; osIs182 V. Show Description
ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::AtTIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.
|
|
JDW313 |
C. elegans |
jsSi1579; wrdSi58 II. Show Description
wrdSi58 [eft-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140
|
|
JDW324 |
C. elegans |
jsSi1579; wrdSi57 II. Show Description
wrdSi57 [^SEC^eft-3p:TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140
|
|
KG4731 |
C. elegans |
unc-116(ce815[LoxP+sup-1(e995)+LoxP]) III. Show Description
Lox P sites in 3' UTR and 4th intron flank kinesin motor domain sequences; sup-1(e995) mini-gene inserted in second intron. Appears wild-type on plates and in quantitative locomotion assays. Can be used to conditionally delete gene sequences encoding the conventional kinesin motor domain in a tissue specific manner by driving expression of Cre recombinase in the tissue of interest. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.
|
|
LP162 |
C. elegans |
nmy-2(cp13[nmy-2::GFP + LoxP]) I. Show Description
cp13[nmy-2::gfp + LoxP] I. GFP inserted into the endogenous nmy-2 gene by Cas9-triggered homologous recombination. Green fluorescence in many tissues, especially the germline. Fluorescence is similar to, but brighter than, the nmy-2::GFP transgene zuIs45. Reference: Dickinson DJ, et al. 2013 Nature Methods Advance Online Publication. DOI: 10.1038/nmeth.2641.
|
|
LP172 |
C. elegans |
hmr-1(cp21[hmr-1::GFP + LoxP]) I. Show Description
cp21[hmr-1::GFP + LoxP] I. GFP inserted at the C terminus of endogenous hmr-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. GFP expression in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
|
|
LP176 |
C. elegans |
unc-119(ed3) III; che-12(cp25[che-12::GFP + LoxP + unc-119(+) + LoxP]) V. Show Description
N-terminally tagged GFP::CHE-12. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.
|
|
LP177 |
C. elegans |
unc-119(ed3) III; che-12(cp26[GFP + LoxP + unc-119(+) + LoxP]) V. Show Description
Entire che-12 coding sequence deleted and replaced with GFP. This produced a phenotype that is more penetrant than that reported for the original che-12 strain, which introduced a nonsense mutation midway through the coding region. Short amphid and phasmid cilia. Defective chemotaxis to NaCl. Dye-filing defective. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.
|
|
LP184 |
C. elegans |
mom-5(cp31[mom-5::YPET + LoxP]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
|
|
LP191 |
C. elegans |
unc-119(ed3) III; hmp-1(cp20[hmp-1::GFP + LoxP unc-119(+) LoxP]) V. Show Description
cp20[hmp-1::gfp + LoxP] V. GFP inserted at the C terminus of endogenous hmp-1 gene by Cas9-triggered homologous recombination. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
|
|
LP198 |
C. elegans |
unc-119(ed3) III; che-12(cp34[gfp::che-12 + LoxP + unc-119(+) + LoxP]) V. Show Description
C-terminally tagged CHE-12::GFP. Cilia are slightly shorter than WT. GFP fluorescence appears in multiple sensory cilia in the head and phasmid neuron cilia in the tail. Reference: Das A, et al. Mol Biol Cell. 2015 Nov 15;26(23):4248-64.
|
|
LP212 |
C. elegans |
pkc-3(cp41[mNeonGreen:3xFlag::pkc-3 + LoxP]) II. Show Description
mNG::aPKC endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
LP216 |
C. elegans |
par-6(cp45[par-6::mNeonGreen::3xFlag + LoxP unc-119(+) LoxP]) I; unc-119(ed3) III. Show Description
PAR-6::mNG endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
LP244 |
C. elegans |
par-6(cp60[par-6::mKate2::3xMyc + LoxP unc-119(+) LoxP]) I; unc-119(ed3) III. Show Description
PAR-6::mKate2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|
LP252 |
C. elegans |
mrck-1(cp65[mrck-1::YPet + LoxP]) V. Show Description
cp65[mrck-1::YPet + LoxP]. YPet inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. Yellow fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
|
|
LP256 |
C. elegans |
nmy-2(cp69[nmy-2::mkate2 + LoxP]) I. Show Description
NMY-2::mKate2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
|
|