Search Strains

axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.

axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Reference: Wang JT, et al. eLife 2014;3:e04591.

axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.

axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.

axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.

axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.

Deletion/insertion (AGCTAGC) of a STOP codon/frameshift near the ATG between IV: 10128909...10128934. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20C. OLLAS-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.

V5 tag inserted at the N-terminus of mbk-2 isoform a. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.

1.6kb deletion in gtbp-1 between IV: 10127256...10128923. Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.

1.6kb deletion in gtbp-1 between IV: 10127264...10128913 and insertion of NheI restriction site (GCTAGC). Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.

GFP inserted at C terminus of endogenous pgl-1 locus. Reference: Putnam A, et al. Nat Struct Mol Biol. 2019 Mar;26(3):220-226.

mCherry tag inserted into endogenous mex-5 locus. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198.

tagRFP tag inserted into endogenous gtbp-1 locus. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.

P granule size reduced, detection of MEG-3 by anti-OLLAS antibody. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

Embryonic P granules not localized, 30% maternal effect sterility on average, RNAi insensitivity. meg-3(ax3056) is an in-frame deletion in the endogenous meg-3 locus removing amino acids (545-862); MEG-3 forms a cytoplasmic gradient but does not form granules in early embryos or recruit other P granule components such as PGL-1/3. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

Description: 20% maternal effect sterility on average, RNAi insensitivity, MEG-3 does not form cytoplasmic gradient. meg-3(ax4503) is an in-frame deletion in the endogenous meg-3 locus removing amino acids (1-544); MEG-3 does not form a cytoplasmic gradient but does still form granules in early embryos and co-localizes with PGL-3. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

tagRFP tag inserted into endogenous gtbp-1 locus. meGFP tag inserted between P121 and V122 of endogenous MEG-3. Reference: Lee, CYS, et al. Elife. 020 Jan 24:9:e52896. doi: 10.7554/eLife.52896. PMID: 31975687.

meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4201) removes the KA1 domain. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay dead embryos), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Replacement of threonine 983 with alanine eliminates PAR-1 asymmetry. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

meGFP inserted between P121 and V122 of endogenous MEG-3. qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP par-1 homozygotes (viable, lay viable progeny that are completely sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. par-1(ax4208) removes the KA1 domain from a GFP-tagged version of PAR-1. Reference: Folkman AW & Seydoux G. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type myo-2::GFP+ and segregate non-myo-2::GFP ax3050; ax4209 homozygotes (maternal effect lethal), wild-type myo-2::GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type myo-2::GFP+ and check for correct segregation of progeny to maintain. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.

qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Homozygous mex-5(ax3050[mCherry::mex-5]); par-1(ax4206[par-1::meGFP]) animals are fully viable and fertile. References: Smith J, et al. eLife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198. Folkman A, et al. Development. 2019 Mar 25;146(6):dev171116. doi: 10.1242/dev.171116. PMID: 30814118.

20% Maternal effect sterility on average, embryonic P granule defect, RNAi insensitivity. Engineered mutations in the endogenous meg-3 locus disrupt the binding and localization of PGL proteins to P granules in the early embryo while MEG-3 itself is still forms an asymmetric cytoplasmic gradient and granules. References: Smith, J. et al. Elife. 2016 Dec 3;5:e21337. doi: 10.7554/eLife.21337. PMID: 27914198 Schmidt H, bioRxiv 2020.10.15.340570 (2020) doi:10.1101/2020.10.15.340570.

The Importin Beta Binding domain (IBB)::mNeonGreen reporter replaces gtbp-1 in the endogenous gtbp-1 locus. Sterile at 25C; maintain at 20C. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans

wrmScarlet tag inserted at C-terminus of endogenous nucl-1 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.

Superficially wild-type. Grows at standard conditions. Reference: Settembre C, et al. Nat Cell Biol. 2013 Jun;15(6):647-58.

Heterozygotes are WT and segregate WT, DpyUncs and dead eggs.

Heterozygotes are WT. Embryos from unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.

Heterozygotes are WT. Embryos from mex-6; unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.

zuIs20 [par-3p::par-3::ZF1::GFP + unc-119(+)]. Lon. Him. Transgenic PAR-3 is subject to ZIF-1-dependent degradation. GFP-tagged PAR-3 that is degraded in early embryonic somatic cells. Rescues the Par phenotype of par-3(it71). Delayed endodermal cell gastrulation. Reference: Nance J, Munro EM, Priess JR. Development. 2003 Nov;130(22):5339-50.

Heterozygotes are WT and segregate WT, Uncs, dead larvae (par-6 homozygotes) and males.

Animals with the duplication are WT. Animals which have lost the duplication are Dpy and give only dead eggs.

Slow growth and a maternal-effect enhancer of the efl-1(se1) embyronic lethal phenotype. Unc.

Heterozygotes are WT and segregate WT, Uncs, Vul and dead eggs. Uncs are homozygous for zu148 and will segregate only dead embryos; the dead embryos will have no morphogenesis and will lack germ cells and intestine.

Heterozygotes are WT and segregate WT, Dpy, Vul and dead eggs. The Dpys give only dead eggs. apx-1 is a maternal effect lethal. zu183 is recessive.

At 20C or 25C, heterozygotes are WT and segregate WT, UncDaf and dead eggs. At 15C, heterozygotes are WT and segregate WT, Uncs and dead eggs.

Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc. [Used to be listed in Kimble lab as unc-5(e53); lag-2(q411 dpy-11(e224)/DnT1. Needs to be checked.] Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUnc and early larval lethals. Received new stock 5/98. Check carefully for segregation of Dpy Unc progeny; dpy-13 can be lost easily. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc. Do not distribute this strain; other labs should request it from the CGC.

At 15C heterozygotes are Rollers and segregate Rollers, Sqt and Steriles. Not a healthy strain; recombination occurs, too. Do not distribute this strain; other labs should request it from the CGC.