Strain Information
| Name | JH3182 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | gtbp-1(ax2035[gtbp-1::TetraCys]) IV. |
| Description | Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Alexandre Paix |
| Laboratory | JH |
Sign in
or
register an account if you want to order this strain.