Search Strains

Dpy. Suppresses presenilin genes. Do not distribute this strain; other labs should request it directly from the CGC.

Dpy. Suppresses presenilin genes. Do not distribute this strain; other labs should request it directly from the CGC.

Heterozygotes are Unc and segregate Uncs and dead eggs. nT1 carries a dominant Unc mutation and a recessive lethal mutation. Do not distribute this strain; other labs should request it from the CGC.

WT phenotype. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Steriles with and Everted Vul and DpyUncs. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Steriles with and Everted Vul and DpyUncs. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

arIs51[cdh-3::GFP]. sel-13=T04A8.10. Reported strong daf-c; raise at 15 C (personal communication to the CGC). Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT (Dpyish) and segregate WT (Dpyish), DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc and segregate Uncs, dead eggs, and Egl. lin-25(ar90) is a probable null mutation. Hermaphrodites are completely unable to lay eggs. Lineage defects in VPCs. Amber mutation (codon 197); amber suppressable. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Uncs and DpySteriles with an everted vulva. Recombines. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc and segregate Uncs, dead eggs, and Egl. lin-25(sy29) is a non-null allele. Hermaphrodites are 100% Egl but some eggs are seen on plates. Results from a missense mutation in codon 103. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are Unc and segregate Unc, dead eggs and lethal Twitchers. Lethal early larval (L1-L2). Maintain by picking Unc. Do not distribute this strain; other labs should request it from the CGC.

arTi355 [rps-27p::GFP(flexon)::Tcut::mScarlet::H2B] IV. arTi237 [ckb-3p::Cre(opti)] X:11.72. Strain for SALSA analysis; pair with control strain GS9322. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.

arTi355 [rps-27p::GFP(flexon)::Tcut::mScarlet::H2B] IV. arTi237 [ckb-3p::Cre(opti)] X:11.72. Reporter-only control for SALSA biosensor; pair with GS9314. Reference: Shaffer JM & Greenwald I. Dev Cell. 2022 Apr 11;57(7):930-944.e6. doi: 10.1016/j.devcel.2022.03.008. PMID: 35413239.

aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR] II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

aSi13 [lox2272 + loxN 3' (delta)Cbr-unc-119(+) + 3' (delta)mNeonGreen::PEST] aSi14[lox2272 + loxP 3’ (delta)HygR + 3’ (delta)mScarlet-I::PEST] II. Unc. Strain contains a set of dual specialized safe harbor transgene landing pads for integration of promoters: one driving mScarlet and rescuing hygromycin resistance upon integration, the other driving mNeonGreen and rescuing the unc phenotype upon integration. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. gwIs59 [pha-4::mCherry::256xLacO::4xLexA + unc-119(+)]. Superficially wild-type. Express ubiquitous EMR-1::mCherry at the nuclear periphery. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red intestine (all stages) and green intestine (from late L4 stage). Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqsi433 [hsp16.41p::FRT::mCherry::his-58::FRT::dam::emr-1 + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain used to perform muscle specific EMR-DamID, to map lamina-associated domains (LADs). Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP::D5 + unc-119(+)] IV. ygIs1 [baf-1p::GFP::lamin(wt) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1. Strain also has cec-4 deletion. Might still carry unc-119(ed3) or (ed9) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421

bqSi447 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::dam + unc-119(+)] II. bqSi495 [myo-3p::FLP_D5 + unc-119(+)] IV. ygIs2 [baf-1::GFP::lmn-1(Y59C) + unc-119(+)]. Strain expressing muscle specific DAM::GFP, used as a control for muscle specific EMR-DamID. Strain also has low level over-expression of GFP::LMN-1 (Y59C mutation). Might still carry unc-119(ed3) in background. Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Slow growing and dumpy. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3’UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. PMID: 26607792

gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.

Superficially wild-type. Reference: Anderson E, et al.Mech Ageing Dev. 2016 Mar;154:30-42.

rtSi8 [sod-1p::sod-1(A4V) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. A4V mutation in C. elegans sod-1 genomic rescue construct mimics human SOD1 disease model. Superficially wild-type with increased sensitivity to paraquat in multiple assays. Strain reportedly carries a him-5 mutation in the background, though specific allele has not been confirmed. HA2619 serves as a control strain for HA2464. [NOTE: This strain was previously incorrectly described as carrying vsIs48; however, the [unc-17::GFP] is present in this strain.] Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.

rtSi1 [sod-1p::sod-1(WT) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. Superficially wild-type. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.

rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752

Superficially wild-type. This is the appropriate control strain for FUS disease models HA2846 and HA2847. This control strain contains presumably silent edits inserted by CRISPR editing while creating the FUS disease models in HA2846 and HA2847, and was back-crossed to remove the pha-1 allele used in strain construction. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

fust-1(rt256[R446S]) was created by CRISPR editing of arginine codon in C. elegans fust-1 to create FUS disease model for human mutation R524S. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2846 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

fust-1(rt257[P447L]) was created by CRISPR editing of proline codon in C. elegans fust-1 to create FUS disease model for human mutation P525L. This strain also contains additional silent edits (also present in control strain HA2845), and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2847 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932

emcSi70 [unc-119p::TIR1::mRuby] (IV: -0.05). TIR1 expression driven by the unc-119 promoter, allowing degradation of AID-tagged proteins specifically in neurons. Reference: Sabatella M, et al. Cell Rep. 2021 Jan 12;34(2):108608. PMID: 33440146

emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). TIR1 expression driven by the myo-3 promoter, allowing degradation of AID-tagged proteins specifically in muscles. Reference: Sabatella M, et al. Cell Rep. 2021 Jan 12;34(2):108608. PMID: 33440146

CRISPR/Cas9-engineered insertion of AID*::GFP tags into N-terminus of endogenous gtf-2H1 locus allowing auxin-induced degradation.

syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

goe3 is a 25 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.

goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding and injection and endogenous hairpin expression.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding only.

Sterile at 25C. Maintain at 20C or lower. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP rike-1(syb1165) homozygotes (early larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Cheng X, et al. Autophagy. 2023 Jan;19(1):241-255. doi: 10.1080/15548627.2022.2071381. PMID: 35521960.

cshIs140 [rps-28p::TIR1(F79G)::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Ubiquitously expressed single copy, modified TIR1 allele, TIR1(F79G) that is compatible with 5-PH-IAA and can be used to deplete auxin-induced degradation-tagged (AID-tagged) proteins. Efficiently depletes target proteins at 1 µM 5-Ph-IAA. Nuclear localized mCherry co-expression marker. Reference: Hills-Muckey et al. Genetics. 2022 Feb 4;220(2):iyab174. doi: 10.1093/genetics/iyab174. PMID: 34739048.

cshIs128 [rps-28p::TIR1::T2A::mCherry::his-11 + Cbr-unc-119(+)] II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Companion strain to HML1012. Harbors conventional allele of TIR1 and Nuclear localized mCherry co-expression marker.

Superficially wild-type except for a slightly shorter body length in adults. Crispr/Cas9 was used to create a 13 bp deletion in exon7 of ccar-1a; breakpoints: CTGATTCGGGAG/sda11/ATCGGAAGTTTC. sda11 is an isoform-specific deletion allele. It only affects the function of CCAR-1A and CCAR-1D, but not CCAR-1B and C. In addition, because CCAR-1D is not expressed in embryos,this allele can be used to specifically inactivate CCAR-1A (the full-length isoform that is the most similar to human CCAR1) during embryogenesis. Reference: Fu R, et al. J Cell Sci. 2018 May 10.

Dominant ts maternal-effect embryonic lethal. Embryos show extensive cytoplasmic blebbing, often accompanied by small spindles and incomplete cytokinesis. Two cell embryos divide synchronously. Embryos arrest with eight to several hundred cells. Recessive non-ts maternal-effect embryonic lethal. Null may be WT. Maintain at 15C.