More Fields
Strain Species Genotype
CB318 C. elegans unc-30(e318) IV. Show Description
Unc-cannot back. Recessive.
CB845 C. elegans unc-30(e191) IV. Show Description
Unc-cannot back up.
SD39 C. elegans unc-30(e596) IV. Show Description
Unc. Allele specific suppression by smg-1(e1228), sup-5(e1464) and sup-7(st5) [in descending order of suppression].
VC295 C. elegans unc-30(ok613) IV. Show Description
B0564.10. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
EW49 C. elegans unc-30(e191) IV; deIs12. Show Description
deIs12[bar1p::GFP + pSC11(unc-30(+))]. Green worms that are non-Unc.
DA491 C. elegans dpy-20(e1282) unc-30(e191) IV. Show Description
Unc. Temperature sensitive Dpy.
MT6505 C. elegans sem-4(n1378) I; unc-30(e165) IV. Show Description
CGC64 C. elegans unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs50] (IV;V;f). Show Description
umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.
EW45 C. elegans smg-1(e1228) I; unc-30(e191) IV; deIs1. Show Description
deIs1[unc-30(+) + lin-39TL::GFP (yeast DNA)]. A translational fusion of GFP to the C terminus of LIN-39. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JJ1238 C. elegans unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). Show Description
Heterozygotes are WT. Embryos from unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.
TY156 C. elegans unc-30(e191) dpy-4(e1166) IV; yDp1 (IV;V;f). Show Description
Animals with the Dup are WT. Animals which have lost the Dup are DpyUnc. Maintain by picking WT.
CGC30 C. elegans unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs19] (IV;V;f). Show Description
umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.
MT5729 C. elegans dpy-20(e1282) unc-30(e191) ced-3(n717) IV. Show Description
Dpy (ts). Unc. Abnormal cell death. Cells that normally die survive.
JJ1244 C. elegans mex-6(pk440) II; unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). Show Description
Heterozygotes are WT. Embryos from mex-6; unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.
VC2742 C. elegans unc-30(gk3024) Y67A10A.104(gk3025) IV; str-183(gk3061) V; ZC374.2(gk1222) X. Show Description
ZC374.2, B0564.10, Y67A10A.104, T13F3.1. The allele gk1222 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 1618 bp. Deletion left flank: CATTTTTCAGTGCTGTTTCTTCCACATTAT. Deletion right flank: TCAGATCTTCTAACTCGCGTTTCTAACTTT. The allele gk3024 was identified by CGH but not confirmed by PCR. Left flanking probe: TTTCGACTGCTGCAAATTTGGCACCTCTACCAACGTGAGTTTTACGGATA. Right flanking probe: TTGTTTGAGCTGCCGGGATGCCAGGAGGAGGGAACAGACAGAGCAGGTAT. Left deleted probe: AAAAATTATAATTTACATTTTTCCAGAGCCCAAGCTGCATTCTCCACATC. Right deleted probe: TTCCTCATCGCTCGGCCAACCTTATCAACCCTGTCAGTACAGTGGACCAC. The allele gk3025 was identified by CGH but not confirmed by PCR. Left flanking probe: GGGATTCGTGGTCGAGATTGCCAGTCCAAGGCTTGGTCGGTTTCAGGTTG. Right flanking probe: GGTTAATGTGAAACTTGATTTAACTGTTCCACGAGTATGCTTTAACAATA. Left deleted probe: TGATTCGCAAAAACAACGAATTGTATAGAACTCACACTTTAAGACATCTA. Right deleted probe: AAATTGCTTACTGACTTTGATGCAAAACAGGTGATTTTTCGGGTTCTAAA. The allele gk3061 was identified by CGH but not confirmed by PCR. Left flanking probe: CAGATTATCTCACTTACTGTTATTGCATATTGTGGGACATGTTGCTACTA. Right flanking probe: GGATCACATACTAAACTTAATTCTTTTCAGACCGCAATACCAATGCTTCT. Left deleted probe: ATATTGTGGGACATGTTGCTACTATAAAATACAACAGCAAATGAGGGTTG. Right deleted probe: ACCTACATCGTCAACTGTTCTACGCTTTGGCAATCCAGGTTTGACGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MT15537 C. elegans unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X. Show Description
Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
AY188 C elegans unc-30(ok613) IV; acEx188. Show Description
acEx188 [unc-30(+) + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by its own promoter rescues unc-30(ok613). Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.
AY189 C. elegans unc-30(ok613) IV; acEx189. Show Description
acEx189 [rab-3p::unc-30 + myo-2::mCherry]. Pick mCherry+ animals to maintain. Expression of unc-30 driven by rab-3 neuronal promoter rescues unc-30(ok613) in neurons. Reference: Otarigho B & Aballay A. Cell Rep. 2021 May 25;35(8):109187. doi: 10.1016/j.celrep.2021.109187. PMID: 34038721.
KRA235 C. elegans pha-1(e2123) III; kasEx80. Show Description
kasEx80 [oig-1p::tagRFP::unc-54 3'UTR + pha-1(+)]. Maintain at 25C to maintain array. RFP driven by minimal oig-1 promoter for expression in VD-type GABAergic motor neurons. This construct uses the minimal length of promoter containing overlapping LIN-39 and UNC-30 ChIp-seq peaks (deletion of the single LIN-39 binding site within it compromised GABAergic motor neuron expression). Whereas other available oig-1 constructs are expressed ectopically in cholinergic motor neurons in unc-3 mutants, expression of this construct remains exclusively in GABAergic motor neurons. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
MT8536 C. elegans nEx648. Show Description
nEx648 [hsp::unc-30 (PD 49-78 and PD 49.3) + rol-6(su1006)]. Pick Rollers to maintain.
OH17515 C. elegans unc-30(ot1186) IV; ric-4(syb2878[ric-4::T2A::3xNLS::GFP]) V. Show Description
Null allele of unc-30 generated by gRNAs targeted to the first and last exons, resulting in a 5168 bp deletion from -37 to +5131 relative to the start of the ORF. Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341
OP395 C. elegans unc-119(tm4063) III; wgIs395. Show Description
wgIs395 [unc-30::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (
OS12700 C. elegans unc-30(ns959[unc-30::GFP::degron]) IV. Show Description
Linker with GFP tag and degron inserted at the C terminus of the endogenous unc-30 locus. GFP expression in ASG, AVJ, DD, VD, and PVP neurons and GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
OH10851 C. elegans juIs14 IV; unc-3(e151) X; otEx4812. Show Description
otEx4812 [unc-30p(2.6kb promoter)::unc-3(cDNA)::unc-54 3'UTR + myo-2::GFP]. juIs14 [acr-2p::GFP + lin-15(+)]. Maintain by picking myo-2::GFP(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.
OH12499 C. elegans otEx5663. Show Description
otEx5663 [unc-30p::GFP::rab-3::unc-10 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Synaptic GFP marker in D-type motor neurons.