bqSi195 [(pBN65) hsp-16.41p::Dam::Myc::lmn-1 + unc-119(+)] II. Strain for DamID mapping of chromatin associated with the nuclear lamina/LMN-1. Made by MosSCI using strain EG4322 for injection. Might still carry unc-119(ed9) III, which is rescued by bqSi195. Reference: González-Aguilera C, et al. Genome Biol. 2014 Feb 3;15(2):R21.

bqSi196 [hsp-16.41p::GFP::Myc::Dam + unc-119(+)] II. Strain for DamID mapping of chromatin associated with the nuclear lamina/LMN-1. Made by MosSCI using strain EG4322 for injection. Might still carry unc-119(ed9) III, which is rescued by bqSi196. Reference: González-Aguilera C, et al. Genome Biol. 2014 Feb 3;15(2):R21.

bqSi218 [hsp-16.41p::Dam::Myc::emr-1 + unc-119(+)] II. Strain for DamID mapping of chromatin associated with the nuclear lamina/LMN-1. Made by MosSCI using strain EG4322 for injection. Might still carry unc-119(ed9) III, which is rescued by bqSi218. Reference: González-Aguilera C, et al. Genome Biol. 2014 Feb 3;15(2):R21.

tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.

Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.

Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.

bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.

Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.

N-terminal tag of SOD-2 via CRISPR/Cas9 knock-in of mScarlet at sod-2 locus. Insertion verified by PCR and fluorescence. Left flank: 5' attgaatattttaattatttgcagccgaaa 3'; Right flank: 5' ATGCTTCAAAACACGGTTCGCTGTGTCTCA 3’ (1 silent mutation); sgRNA: AAGCTTTGAGACACAGCGAA; Cas9/sgRNA plasmid: pGLOW98; mScarlet^SEC^3xMyc plasmid: pGLOW111; SEC insertion allele strain: GLW64.

N-terminal tag of SOD-5 via CRISPR/Cas9 knock-in of mScarlet at sod-5 locus. Insertion verified by PCR and fluorescence. Left flank: 5' tgtgctaacgaaaattttactaaaaggaaa 3'; Right flank: 5' ATGGATATTCTCTCTGATATTGCAAATGCC 3’ (1 silent mutation); sgRNA: tacCTGTGGAAGAACGGCAT; Cas9/sgRNA plasmid: pGLOW122; mScarlet^SEC^3xMyc plasmid: pGLOW129; SEC insertion allele strain: GLW78.

N-terminal tag of PQE-1 via CRISPR/Cas9 knock-in of mScarlet at pqe-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CCAGATGCGAAAGCGAACAG 3’ ; rev – 5’ TGTACTTACCGGAATCGGCG 3’. Left flank: 5' ttaataatcattccagcaagtatctcagcc 3'; Right flank: 5' ATGTTTAATGGCGGCTATGGATCTGGAAAC 3’; sgRNA: atctcagccATGTTTAATGG; Cas9/sgRNA plasmid: pGLOW143; mScarlet^SEC^3xMyc plasmid: pGLOW142; SEC insertion allele strain: GLW84.

N-terminal tag of UBQL-1 via CRISPR/Cas9 knock-in of mScarlet at ubql-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ AGGGCGAGAGATTATCGGGA 3’; rev – 5’ CGGATCGTTGAGAATGTGTCC 3’. Left flank: 5' gtcggttttttaatatttctcaaatttaag 3'; Right flank: 5' ATGGCTACAGAGAGTGCACTCATCAAAGTTCACGTGAAATCACCCT 3’ (7 silent mutations); sgRNA: TCAACGTCATACTTGTTCGA; Cas9/sgRNA plasmid: pGLOW134; mScarlet^SEC^3xMyc plasmid: pGLOW145; SEC insertion allele strain: GLW88.

C-terminal tag of HRPA-1 via CRISPR/Cas9 knock-in of mScarlet at hrpa-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ GTCTCCACCAAACGCCTGTA 3’ ; rev – 5’ CTAGCCTGTGTCCCATCAGC 3’. Left flank: 5' AATGGGCCCACGCCCAGGGAGGAAACAGAAACTAT 3' (5 silent mutations); Right flank: 5' TAAattaattccttaagcccctctaagtgt 3’; sgRNA: CAGTGGGCTCATGCTCAAGG; Cas9/sgRNA plasmid: pGLOW144; mScarlet^SEC^3xMyc plasmid: pGLOW153; SEC insertion allele strain: GLW90.

N-terminal tag of CLIC-1 via CRISPR/Cas9 knock-in of mScarlet at clic-1 locus. Insertion verified by PCR and fluorescence. Genotyping primers: fwd – 5’ CTCGTACCAATCGTCCGCAA 3’; rev – 5’ CCATCTTGTTGCTTGGCGAAA 3’. Left flank: 5' ccagggtataaaacacaaaaaaactacaaa 3'; Right flank: 5' ATGTCGGATCCAGTCGCGGATTTTTTGGCT 3’ (1 silent mutation); sgRNA: ctacaaaATGTCGGATCCAG; Cas9/sgRNA plasmid: pGLOW128; mScarlet^SEC^3xMyc plasmid: pGLOW156; SEC insertion allele strain: GLW92.

mScarlet::3xMyc tag inserted at the C-terminus of the endogenous nhr-23 locus by CRISPR. A flexible 30 amino acid linker is between the nhr-23 coding sequence and mScarlet. Allele obtained using the self-excising casstte, following Dickinson et al, 2015 method. Reference: Myles KM, et al. MicroPubl Biol. Oct 2:2023:10.17912/micropub.biology.000996. doi: 10.17912/micropub.biology.000996. eCollection 2023. PMID: 37854098.

wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.

Myc tag inserted at N-terminus of swan-1. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.

Express tagged htp-3. Reference: Paix A, et al. Genetics. 2015 Sep;201(1):47-54.

qEx319 [lag-2::cMyc + rol-6(su1006)].  Rollers.  Extrachromosomal array carrying myc-tagged LAG-2 protein partially rescues lag-2(null).  About 70% of progeny are Lag.  Survivors are Rollers.  Reference: Crittenden et al., Mol Biol Cell. 2006 Jul;17(7):3051-61.

qSi77 [mex-5p::eGFP::3xFLAG::tbb-1 3'utr::gpd-2 SL2 splice site::mCherry::3xMyc::pgl-1 RGG repeat::tbb-1 3'utr and intergenic region + unc-119(+)] inserted into ttTi5605 on LG II. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.

qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.

qSi41 [fog-3::3xFLAG + unc-119(+)] inserted into ttTi5605 on LG II. qSi140 [3xMyc::fog-1 + unc-119(+)] inserted into cxTi10816 on LG IV. Can be maintained at 20C. qSi41 rescues fog-3 null phenotype. qSi140 rescues fog-1 null phenotype. References: Noble DC, et al. Genetics. 2016 Jan;202(1):221-34.

Internal 3xMyc tag inserted into endogenous cya-1 locus.

3xMyc tag inserted at N-terminus of endogenous cyb-2.1 locus.

3xMyc tag inserted at N-terminus of endogenous cyb-2.2 locus.

Internal 3xMyc tag inserted into endogenous cyb-3 locus.

Internal 3xMyc tag inserted into endogenous cyd-1 locus.

3xMyc tag inserted at N-terminus of endogenous cye-1 locus.

3xMyc tag inserted at N-terminus of endogenous cdk-1 locus.

tagRFP-T and 3xMyc tags inserted into endogenous gip-1 locus. No overt phenotypes. RFP fluorescence is observed at microtubule-organizing centers, though generally much dimmer than the GFP allele gip-1(wow3). Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.

The Auxin Inducible Degron (AID) flanked by a 5X Myc/spacer tag on left and a single spacer on the right is fused to the N-terminus of the unc-104 gene. Allows conditional degradation of UNC-104 protein when combined with tissue specific expression of TIR1 in the presence of 1 mM Auxin in plate media. Note: KG5148 does not express TIR1. On standard plates: wild type growth, appearance, and locomotion rate. For animals expressing a TIR1 transgene in the nervous system: Animals that hatch and develop on 1 mM Auxin plates generally remain tightly coiled near the location of hatching and exhibit slow growth (up to 7 days to reach adulthood, with 98% reaching adulthood by 7 days). Adults placed on Auxin abruptly lose about 75% of their locomotion function between 6 and 12 hours after plating. The remaining locomotion function is lost gradually between 12 and 52 hours. Reference: Stec N, et al. (Submitted). An Intron Compatible Marker for Long Distance CRISPR Mediated Gene Editing in Caenorhabditis elegans.

huIs7 [hsp-16.2p::Myc::bar-1(delta N) + mec-7p::GFP + dpy-20(+)]. Muv. Posterior migration of the QR descendants. Reference: de Groot et al. (2014) Science Signal. Ra26.

lqIs126 [rack-1::MYC + osm-6::GFP]. lqIs126 rescues sterility, gonadal distal tip cell migration defects, and axon pathfinding defects caused by rack-1(tm2262). Reference: Demarco RS, Lundquist EA. PLoS Genet. 2010 Nov 18;6(11):e1001215.

PAR-6::mKate2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID) peptide. Endogenous pash-1 tagged with the AID peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.

syEx1155 [myo-3p::tomm-20::mRFP::3xMyc + Cbr-unc-119(+)]. Maintain at 15C. Pick non-Unc to maintain array.

zcIs21 contains [hsp-16p::clpp-1(WT)::3xmyc-His tag + myo-3p::GFP].

zcIs40 [dve-1p::dve-1::3xmyc-His tag + myo-3p::GFP].

zcIs41 contains [ubl-5p::3xmyc-His tag::ubl-5 + myo-3p::GFP].

zcIs22 contains [hsp-16p::clpp-1(delta SS)::3xmyc-His tag + myo-3p::GFP].

zcIs39 contains [dve-1p::dve-1::GFP]. zcIs41 contains [ubl-5p::3xmyc-His tag::ubl-5 + myo-3p::GFP].

CRISPR/Cas9 engineering used to insert N-terminal Myc tag into the endogenous rpa-4 locus, N-terminal 3xFLAG tag into the endogenous rpa-2 locus, and N-terminal OLLAS tag into the endogenous rpa-1 locus. SSM559 was generated by crossing rpa-2(iow49) with rpa-1(iow92), followed by CRISPR insertion of the Myc tag into rpa-4. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.

ncEx9005 [lin-32p::FLAG::let-363 + lin-32p::Myc::daf-15 + lin-32p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing lin-32p followed by the FLAG-, Myc- and HA-coding sequences to generate lin-32p::FLAG::let-363, lin-32p::Myc::daf-15 and lin-32p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.

ncEx9007 [unc-54p::FLAG::let-363 + unc-54p::Myc::daf-15 + unc-54p::HA::rict-1 + hsp16-2p::plx-1 + rol-6(su1006)]. Rollers. Pick Rollers to maintain. KpnI sites were added by PCR to let-363, daf-15 and rict-1 cDNAs and inserted into pPD49.26 containing inserted into pPD30.38 containing unc-54p followed by the FLAG-, Myc- and HA-coding sequences to generate unc-54p::FLAG::let-363, unc-54p::Myc::daf-15 and unc-54p::HA::rict-1, respectively. Reference: Nukazuka A, et al. Nat Commun. 2011 Sep 27;2:484.