| AMH50 |
C. elegans |
juIs76; bec-1(ok691) IV/nT1 [qIs51] (IV;V). Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-pharyngeal GFP bec-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. |
|
| AP36 |
C. elegans |
mep-1(ok421) IV/nT1 [qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok421 homozygotes, wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Received new stock 12/02. |
|
| ATD1 |
C. elegans |
unc-119(ed3) III; sqt-3(sc8) par-1(b274) V/nT1[unc-?(n754) let-?] (IV;V); zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced heterozygotes are Unc and segregate Unc (heterozygotes), Rol Par (sqt-3 par-1 homozygotes; maternal effect lethal), and dead eggs (nT1 homozygotes). NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK288. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231. |
|
| AV106 |
C. elegans |
spo-11(ok79) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc spo-11 homozygotes, and dead eggs (nT1 homozygotes). spo-11 homozygotes produce an average of ~200 fertilized eggs but only about 0.1 progeny survive to adulthood. When mated to N2 males, spo-11 homozygotes will produce at least 5-10 cross progeny. |
|
| AV112 |
C. elegans |
mre-11(ok179) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc mre-11 homozygotes, and dead eggs (nT1 homozygotes). mre-11 homozygotes produce about 200 fertilized eggs but only about 2-3% of these eggs survive to adulthood (this mutation cannot be maintained in a homozygous condition). Occasionally non-Unc progeny that do not demonstrate the mre-11(ok179) mutant phenotype arise when grown in large liquid cultures. mre-11 is the predicted gene ZC302.1 |
|
| AV115 |
C. elegans |
msh-5(me23) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc msh-5 homozygotes, and dead eggs (nT1 homozygotes). msh-5 homozygotes give 97.9% dead eggs; of those that hatch, 42% are male. |
|
| AV157 |
C. elegans |
spo-11(me44)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc spo-11(me44) homozygotes, and dead eggs (nT1 homozygotes). spo-11(me44) homozygotes are viable and produce more than 90% dead eggs (a large fraction of the survivors are males — strong Him phenotype); cytologically they lack chiasmata in diakinesis-stage oocytes and lack RAD-51 foci. Maintain by picking Unc. |
|
| AV271 |
C. elegans |
him-3(me80)/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc him-3(me80) homozygotes, and dead eggs (nT1 homozygotes). him-3(me80) homozygotes are viable and non-Unc. They produce more than 85% dead eggs and a large fraction (11%) of the survivors are males (Him phenotype). Cytologically they exhibit a reduced level of HIM-3 loading and fewer stretches of SYP-1 than WT. In diakinesis-stage oocytes, they contain a mixture of bivalents and univalents. Maintain by picking Unc. |
|
| AV276 |
C. elegans |
syp-2(ok307) V/nT1 [unc-?(n754) let-?(m435)] (IV;V). Show Description
Balanced heterozygotes are Unc and segregate Unc (heterozygotes), non-Unc syp-2(ok307) homozygotes, and dead eggs (nT1 homozygotes). syp-2(ok307) homozygotes are viable and non-Unc. They produce 96% dead eggs and 44% males; cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. |
|
| AV307 |
C. elegans |
syp-1(me17) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Balanced heterozygotes are GFP+ Unc and segregate GFP+ Unc (heterozygotes), non-GFP non-Unc syp-1(me17) homozygotes, and dead eggs (nT1 homozygotes). syp-1(me17) homozygotes produce 95% dead embryos and 38% males. Cytologically they lack chiasmata in diakinesis-stage oocytes, exhibit persistent polarized nuclear organization during earlier meiotic prophase, lack synaptonemal complexes, and exhibit unstable pairing of homologous chromosomes. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. |
|
| AV473 |
C. elegans |
rad-50(ok197) V/nT1 [qIs51] (IV;V). Show Description
qIs51 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP]. Heterozygotes are wild-type GFP+ and segregate non-GFP ok197 homozygotes (viable, sterile), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. rad-50 homozygotes are viable, produce more than 95% dead eggs and a large fraction of the survivors are male (Him phenotype). Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Reference: Hayashi M, et al. PLoS Genet. 2007 Nov;3(11):e191. |
|
| AV554 |
C. elegans |
dpy-13(e184) unc-5(ox171) IV/nT1 [qIs51] (IV;V); krIs14 V/nT1 [qIs51] (IV;V). Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. Heterozygotes are WT with GFP (GFP+ coelomocytes & GFP+ pharynx), and segregate WT GFP, arrested nT1[qIs51] aneuploids, and Dpy Unc homozygotes (GFP+ pharynx & GFP+ coelomocytes). Homozygous nT1[qIs51] inviable. Pick WT with GFP (GFP+ pharynx & GFP+ coelomocytes) and check for correct segregation of progeny to maintain. References: Robert V & Bessereau JL. EMBO J. 2007 Jan 10;26(1):170-83. doi: 10.1038/sj.emboj.7601463. PMID: 17159906. Rosu S, et al. Science. 2011 Dec 2;334(6060):1286-9. doi: 10.1126/science.1212424. PMID: 22144627. Toraason E, et al. Elife. 2024 Aug 8;13:e80687. doi: 10.7554/eLife.80687. PMID: 39115289. |
|
| BAN362 |
C. elegans |
micu-1(bon20) IV/nT1[qIs51] (IV; V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP bon20 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. micu-1(bon20) CRISPR/Cas9-engineereed deletion removing most of the region between exons 1-3 abrogating the expression of all predicted MICU-1 isoforms. Genotyping primers (bon20 allele): Fwd GGTGGATGATCCGGGATAC, Rev CAGTGGCCATGGGCACC; micu-1(bon20): ~675 bp; WT: no product unless using longer extension time. Reference: Jackson J, et al. Mol Metab. 2022 Jul:61:101503. doi: 10.1016/j.molmet.2022.101503. PMID: 35452878. |
|
| BAN500 |
C. elegans |
micu-1(bon20) IV/nT1[qIs51] (IV;V); emre-1(bon78) X. Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP bon20 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. micu-1(bon20) CRISPR/Cas9-engineereed deletion removing most of the region between exons 1-3 abrogating the expression of all predicted MICU-1 isoforms. Genotyping primers (bon20 allele): Fwd GGTGGATGATCCGGGATAC, Rev CAGTGGCCATGGGCACC; micu-1(bon20): ~675 bp; WT: no product unless using longer extension time. emre-1(bon78) is a CRISPR/Cas9-engineered insertion into exon 2. Genotyping primer for emre-1(bon78): caacagcccccggcggcgt and catcgtcgtcttcatcggttggcac; emre-1(bon78): 221 bp; WT: 200 bp. Reference: Jackson J, et al. Mol Metab. 2022 Jul:61:101503. doi: 10.1016/j.molmet.2022.101503. PMID: 35452878. |
|
| BAN925 |
C. elegans |
bcl-11(bon172) V/nT1[umnIs49] (IV;V). Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+ and segregate wild-type mKate2+, very few non-mKate arrested larvae (bon145 homozygotes mostly Emb), Vul mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type mKate2+. bcl-11(bon172) is a CRISPR/Cas9-engineered deletion causing truncation of BCL-11 lacking ∼196 amino acids and carrying a predicted triple HA sequence (3xHA) at the C terminus. Genotyping primers: Fw GTGAGCTTGCTGAGCCAGCT and Rev CGGGTAAGAGAAGATTGAGCGCAA; bcl-11(bon172): ~250 bp; WT: NO PRODUCT. Reference: Niedworok P, et al. 2026 Jan 7;29(2):114422. doi: 10.1016/j.isci.2025.114422. PMID: 41641102. |
|
| BC1201 |
C. elegans |
sDf19/nT1 IV; +/nT1 V. Show Description
sDf19 has a dominant twitcher phenotype, and is homozygous lethal-usually arresting as embryos, but occasionally will hatch. Heterozygotes are twitchers and segregate twitchers, Vulvaless and dead eggs (or lethal early larvae). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. |
|
| BC1216 |
C. elegans |
sDf21 dpy-4/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. |
|
| BC1217 |
C. elegans |
sDf22/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. |
|
| BC1227 |
C. elegans |
sDf23/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. |
|
| BC1291 |
C. elegans |
let-93(s734) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. |
|
| BC1519 |
C. elegans |
dpy-18(e364)/eT1 III; sDf31/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. Original isolation: BO strain BC1261 unc-22(s727) hermaphrodite heat shocked for 1 hour at 34C. Crossed to N2 strain BC1270 unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Picked individual WT hermaphrodites. Screened for the absence of gravid Unc-22. Retained strain as BC1379. Balanced over eT1: BC1379 unc-22(s727)[BO]/nT1[N2] IV; sDf31[BO]/nT1[N2] hermaphrodite crossed to BC 1265 dpy-18(e364)/eT1 III; unc-46(e177)/eT1 V. Pick WT hermaphrodites that twitch in 1% nicotine. Retained one strain that segregated Unc-36 as BC1428. Pseudolinked sDf31 to dpy-18: BC1428 +/eT1 III; sDf31[BO]/eT1 V crossed to BC 1265 dpy-18/eT1 III; unc-46/eT1 V male. Picked WT hermaphrodite F1. From strains segregating Unc-36 but no Dpy or Unc-46 or DpyUnc-46, cross WT hermaphrodites to BC1265 males. From strains producing Dpy, crossed individual WT males to BC70 eT1;eT1. From each cross, crossed WT X WT. Kept one strain producing on Dpy or DpyUncs as S-H716 male. Picked one hermaphrodite to start BC1519. Comments: 1) The LGV region balanced by eT1 should be all BO. 2) Probably the rest of the genome still has a considerable amount from BO since it was crossed to N2 only 4 times. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie. |
|
| BC1548 |
C. elegans |
unc-22(s7) let-67(s214)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Twitcher Steriles. The sterility can be rescued by male sperm. |
|
| BC1907 |
C. elegans |
let-68(s1081) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and LetUncTwitcher. Lethal ??. Maintain by picking WT. |
|
| BC1912 |
C. elegans |
let-652(s1086) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Egl, dead eggs and UncLets. Lethal early larval. Maintain by picking WT. |
|
| BC2001 |
C. elegans |
let-98(s1117) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal late larval. Maintain by picking WT. |
|
| BC2003 |
C. elegans |
let-96(s1112) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Lethal Twitchers and dead eggs. Lethal mid-larval. Maintain by picking WT. |
|
| BC2008 |
C. elegans |
unc-22(s7) unc-31(e169) let-315(s1101)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal mid-larval. Maintain by picking WT. |
|
| BC2010 |
C. elegans |
let-60(s1124) unc-22(s7) unc-31(e169) IV/nT1 (IV;V). Show Description
Heterozygotes are WT and segregate WT, Vul and UncLethals. Strong allele of let-60. Unc Twitchers arrest as rod-like early larvae; rare escapers die as Vul adults. |
|
| BC2013 |
C. elegans |
unc-22(s7) let-97(s1121) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, UncLet (Twitcher), Vul, and dead eggs. Lethal early larval. Maintain by picking WT. |
|
| BC2020 |
C. elegans |
let-70(s1132) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet (twitchers) and dead eggs. Lethal early larval. Maintain by picking WT. See also WBPaper00002501. |
|
| BC2021 |
C. elegans |
let-289(s1133) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! |
|
| BC2024 |
C. elegans |
let-291(s1139) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! |
|
| BC2029 |
C. elegans |
let-60(s1155) unc-22(s7) unc-31(e169) IV/nT1 (IV;V). Show Description
Heterozygotes are WT and segregate WT, Vul and Twitcher UncLethals. s1155 is viable; 14% Vul. |
|
| BC2034 |
C. elegans |
let-292(s1146) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! |
|
| BC2035 |
C. elegans |
unc-22(s7) unc-31(e169) let-317(s1153)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Egl, UncLet and dead eggs. Lethal at embryo-early larval. Maintain by picking WT. |
|
| BC2036 |
C. elegans |
let-100(s1160) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal early larval. Maintain by picking WT. |
|
| BC2037 |
C. elegans |
let-293(s1166) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are short and somewhat Egl. Offspring are short. Segregate Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Not outcrossed! |
|
| BC2047 |
C. elegans |
let-290(s1140) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! |
|
| BC2049 |
C. elegans |
let-658(s1149) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, UncLet, Egl and dead eggs. Maintain by picking WT. |
|
| BC2053 |
C. elegans |
let-307(s1171) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Egl, Lethal Twitchers and dead eggs. Lethal mid-larval. Maintain by picking WT. |
|
| BC2060 |
C. elegans |
let-311(s1195) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal late larval. Maintain by picking WT. |
|
| BC2061 |
C. elegans |
let-69(s1111) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Egl, Lethal Twitchers and dead eggs. Lethal early larval. Maintain by picking WT. |
|
| BC2063 |
C. elegans |
unc-22(s7) let-309(s1115) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal late larval. Maintain by picking WT. |
|
| BC2067 |
C. elegans |
let-659(s1152) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, UncLet, Egl and dead eggs. Maintain by picking WT. |
|
| BC2069 |
C. elegans |
let-651(s1165) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Lethals and dead eggs. Maintain by picking WT. |
|
| BC2070 |
C. elegans |
let-294(s1103) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! |
|
| BC2079 |
C. elegans |
unc-22(s7) unc-31(e169) let-301(s1134)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet, and dead eggs. Lethal early larval. Maintain by picking WT. |
|
| BC2088 |
C. elegans |
let-295(s1175) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed! |
|
| BC2094 |
C. elegans |
unc-22(s7) unc-31(e169) let-313(s1135)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Sterile Unc, and dead eggs. Maintain by picking WT. |
|
| BC2105 |
C. elegans |
let-308(s1705) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Egl, Lethal Twitchers and dead eggs. Lethal mid-larval. Maintain by picking WT. |
|