CB315 |
C. elegans |
unc-34(e315) V. Show Description
Unc. Male spicules abnormal. Recessive. M-MATING-NO SUCCESS.
|
|
CB566 |
C. elegans |
unc-34(e566) V. Show Description
Unc.
|
|
LE983 |
C. elegans |
unc-34(lq17) V. Show Description
|
|
OX977 |
C. elegans |
unc-34(gm104) V. Show Description
Unc. According to Withee (2004), gm104 has been sequenced and introduces an early amber stop at W24. Reference: Withee J, et al. Genetics. 2004 Jul;167(3):1165-76. PMID: 15280232
|
|
KX10 |
C. elegans |
ife-3(ok191)/unc-34(e566) V. Show Description
At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
|
|
MT6185 |
C. elegans |
dpy-1(e1) III; unc-34(e566) V. Show Description
Mapping strain. Unc is ts.
|
|
MT4446 |
C. elegans |
unc-34(e566) unc-60(e677) dpy-11(e224) V. Show Description
Dpy. Unc.
|
|
QP218 |
C. elegans |
unc-34(e315) dpy-11(e224) rol-9(sc148) V. Show Description
Unc. Dpy. Rol(ts).
|
|
JK1219 |
C. elegans |
unc-34(e315) lag-2(q387) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
DQM1152 |
C. elegans |
bmdSi243 I; ljf3(unc-34::mNG[C1]^3xFlag::AID) V; qy41(lam-2::mKate2) X. Show Description
bmdSi243 (LoxN + cdh-3p::TIR1::F2A::DHB::2xmTurquoise2) I. bmdSi243 is a MosSCI insertion. mNG tag inserted into the C-temrinus of the endogenous unc-34 locus. mKate2 tag inserted into the C-temrinus of the endogenous lam-2 locus.
|
|