More Fields
Strain Species Genotype
CB315 C. elegans unc-34(e315) V. Show Description
Unc. Male spicules abnormal. Recessive. M-MATING-NO SUCCESS.
CB566 C. elegans unc-34(e566) V. Show Description
Unc.
LE983 C. elegans unc-34(lq17) V. Show Description
OX977 C. elegans unc-34(gm104) V. Show Description
Unc. According to Withee (2004), gm104 has been sequenced and introdices an early amber stop at W24. Reference: Withee J, et al. Genetics. 2004 Jul;167(3):1165-76. PMID: 15280232
KX10 C. elegans ife-3(ok191)/unc-34(e566) V. Show Description
At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
MT6185 C. elegans dpy-1(e1) III; unc-34(e566) V. Show Description
Mapping strain. Unc is ts.
MT4446 C. elegans unc-34(e566) unc-60(e677) dpy-11(e224) V. Show Description
Dpy. Unc.
QP218 C. elegans unc-34(e315) dpy-11(e224) rol-9(sc148) V. Show Description
Unc. Dpy. Rol(ts).
JK1219 C. elegans unc-34(e315) lag-2(q387) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. [Note from Kimble lab: Min Han did a complementation test on this strain and found that unc-34(e315) is lost from this strain.] Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.