Strain Information
| Name | JH3199 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | gtbp-1(ax2055[gtbp-1::GFP]) IV. |
| Description | Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Alexandre Paix |
| Laboratory | JH |
Sign in
or
register an account if you want to order this strain.